Incidental Mutation 'R1945:Abca1'
List |< first << previous [record 38 of 1259] next >> last >|
ID216562
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 039963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1945 (G1)
Quality Score117
Status Not validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACGTCTTCACCAGGTAATC to AC at 53061509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably null
Transcript: ENSMUST00000030010
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,768,483 E585V probably damaging Het
4930562C15Rik A G 16: 4,835,685 I33V unknown Het
4931408C20Rik C A 1: 26,682,314 V1262F probably benign Het
Amotl2 T C 9: 102,720,554 S171P probably benign Het
Atf6 A T 1: 170,855,141 V34E probably benign Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bglap A G 3: 88,383,664 Y87H probably damaging Het
Camk2n1 G A 4: 138,456,783 V78I possibly damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Cdc14b T C 13: 64,219,890 Y208C probably damaging Het
Cdc42bpb C T 12: 111,299,133 R1455Q probably damaging Het
Cep170 C A 1: 176,793,534 G26* probably null Het
Cfap46 A G 7: 139,679,903 F217S probably damaging Het
Col11a2 A T 17: 34,059,168 D691V probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Coq8b CGCA CGCAGCA 7: 27,233,980 probably benign Het
Coq8b GCA GCAACA 7: 27,233,981 probably benign Het
Dcaf5 T C 12: 80,338,694 D886G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
Etaa1 A G 11: 17,947,233 C295R probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Ghdc C T 11: 100,769,205 A239T probably benign Het
Gm906 C T 13: 50,245,491 G933E probably damaging Het
Grik4 T C 9: 42,521,004 D899G possibly damaging Het
Hacd2 C A 16: 35,101,984 T181K possibly damaging Het
Havcr2 T C 11: 46,455,050 L17P unknown Het
Herc3 T C 6: 58,887,439 V686A probably damaging Het
Hyal3 T C 9: 107,585,472 L235P probably damaging Het
Itgb4 C T 11: 115,993,453 Q988* probably null Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Lama1 T A 17: 67,745,853 S394T probably benign Het
Lamp1 T C 8: 13,172,545 V243A probably benign Het
Loxhd1 A G 18: 77,404,808 Y1315C probably damaging Het
Macf1 A T 4: 123,490,660 L1148* probably null Het
Mill2 A G 7: 18,841,494 H42R probably benign Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Myo15b A T 11: 115,878,398 I1472F probably damaging Het
Nasp T C 4: 116,622,768 S36G possibly damaging Het
Nav2 A G 7: 49,464,872 Y868C probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Npc1l1 C T 11: 6,225,199 W592* probably null Het
Nsg2 T C 11: 32,055,068 V90A probably damaging Het
Odf4 T C 11: 68,922,157 N225S possibly damaging Het
Olfr1230 T C 2: 89,296,784 Y162C probably damaging Het
Olfr340 T C 2: 36,453,031 W149R probably damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pcdhb4 A T 18: 37,308,868 R410S probably damaging Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pik3ap1 A T 19: 41,274,337 S799T probably benign Het
Pitx2 A G 3: 129,218,536 N198S probably damaging Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Recql5 G A 11: 115,928,297 R148* probably null Het
Reep3 A G 10: 67,035,899 S97P probably damaging Het
Rnase12 T A 14: 51,057,006 Q72L possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Scn10a A T 9: 119,691,454 S127T possibly damaging Het
Scn7a A T 2: 66,675,980 W1522R probably damaging Het
Senp7 A G 16: 56,123,946 H211R probably damaging Het
Sept10 C T 10: 59,181,019 probably null Het
Serpinb6d T C 13: 33,667,680 V140A possibly damaging Het
Sned1 A G 1: 93,271,238 E457G probably benign Het
Spag17 A C 3: 99,939,982 M76L probably benign Het
Ssfa2 T C 2: 79,662,652 V1181A probably benign Het
Sspo A T 6: 48,489,773 E105V possibly damaging Het
Stoml3 T A 3: 53,505,445 D173E possibly damaging Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Svil T C 18: 5,117,059 W2165R probably damaging Het
Tbl2 T A 5: 135,157,600 S184T possibly damaging Het
Tdrd7 A T 4: 45,965,474 T31S probably benign Het
Tmeff1 A G 4: 48,614,960 N139S possibly damaging Het
Trip13 T C 13: 73,927,924 R199G probably damaging Het
Tshb G T 3: 102,777,515 Y124* probably null Het
Ttn T C 2: 76,730,022 E29345G probably damaging Het
Usp33 T A 3: 152,379,586 S620T probably benign Het
Vipr1 G A 9: 121,668,474 G353R probably damaging Het
Vipr1 G T 9: 121,668,475 G353V probably damaging Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Ylpm1 T A 12: 85,015,418 S240T probably damaging Het
Zfp772 A G 7: 7,203,630 I354T probably benign Het
Zfp959 T A 17: 55,897,231 Y86* probably null Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCAGAATTCAAATCTGAGTCCAC -3'
(R):5'- AGGGACAAGTGCCAATGGTC -3'

Sequencing Primer
(F):5'- AGGCAGCCTCGTTCTCTAAG -3'
(R):5'- TGACTGGCTGAGGTTCTTGC -3'
Posted On2014-08-01