Incidental Mutation 'R1946:Ppp2r2d'
ID216684
Institutional Source Beutler Lab
Gene Symbol Ppp2r2d
Ensembl Gene ENSMUSG00000041769
Gene Nameprotein phosphatase 2, regulatory subunit B, delta
Synonyms1300017E19Rik, MDS026, D7Ertd753e
MMRRC Submission 039964-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R1946 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location138846079-138883057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138868467 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041097] [ENSMUST00000136824] [ENSMUST00000148453] [ENSMUST00000155672]
Predicted Effect probably damaging
Transcript: ENSMUST00000041097
AA Change: D53G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040321
Gene: ENSMUSG00000041769
AA Change: D53G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WD40 27 62 1.91e1 SMART
WD40 89 129 4.77e0 SMART
WD40 171 210 1.19e0 SMART
WD40 221 261 1.91e1 SMART
WD40 280 318 4.11e1 SMART
WD40 345 376 2.54e2 SMART
WD40 412 449 3.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128157
Predicted Effect probably damaging
Transcript: ENSMUST00000136824
AA Change: D48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133380
Gene: ENSMUSG00000041769
AA Change: D48G

DomainStartEndE-ValueType
PDB:3DW8|E 6 69 3e-31 PDB
Blast:WD40 15 57 3e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140047
Predicted Effect probably benign
Transcript: ENSMUST00000148453
SMART Domains Protein: ENSMUSP00000119183
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:3DW8|E 14 33 9e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152104
Predicted Effect probably benign
Transcript: ENSMUST00000155672
SMART Domains Protein: ENSMUSP00000119004
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
WD40 6 45 1.19e0 SMART
WD40 56 96 1.91e1 SMART
WD40 115 153 4.11e1 SMART
WD40 180 211 2.54e2 SMART
WD40 247 284 3.82e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172764
AA Change: D19G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133810
Gene: ENSMUSG00000041769
AA Change: D19G

DomainStartEndE-ValueType
SCOP:d1k32a3 2 103 9e-8 SMART
PDB:3DW8|E 2 127 2e-75 PDB
Blast:WD40 56 96 4e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174090
SMART Domains Protein: ENSMUSP00000134581
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
WD40 6 45 1.19e0 SMART
WD40 56 96 1.91e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adamts5 C A 16: 85,899,243 C342F probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Aen G C 7: 78,902,672 E32Q probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgap44 A G 11: 65,012,096 M509T probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
Bmpr2 T C 1: 59,868,397 V883A possibly damaging Het
Bpifa1 A T 2: 154,145,634 I135F probably damaging Het
Bsn A G 9: 108,114,651 F1301L probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Ccdc18 A G 5: 108,228,995 E1434G probably damaging Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Cpn1 G A 19: 43,956,518 T450M probably benign Het
Dlg4 A G 11: 70,039,575 Y432C probably damaging Het
Dnah8 C A 17: 30,712,385 T1458K probably benign Het
Dock5 A T 14: 67,786,316 M1132K probably damaging Het
Dsg2 A G 18: 20,580,548 D192G probably damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fndc11 A T 2: 181,221,834 D144V probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Ganab T A 19: 8,910,808 D439E probably damaging Het
Gm10228 C A 16: 89,041,353 G21V unknown Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gm9573 A T 17: 35,622,524 probably benign Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Gsdmc4 C A 15: 63,902,780 D51Y probably benign Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Kcnq2 T A 2: 181,088,451 D446V probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Lrrcc1 A G 3: 14,550,393 R394G probably benign Het
Lrrk2 G A 15: 91,736,661 probably null Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Msrb3 A G 10: 120,852,008 V54A probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Ncor2 G A 5: 125,034,412 T1314I probably damaging Het
Nes A G 3: 87,978,514 Q1316R possibly damaging Het
Nfe2l3 A C 6: 51,457,315 Q285P probably damaging Het
Nkd1 C T 8: 88,592,117 H357Y probably damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Olfr1333 T C 4: 118,830,026 N139S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr1469 T C 19: 13,410,779 V70A possibly damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Otx1 G T 11: 21,998,482 T46K probably damaging Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Pcdhb16 T A 18: 37,478,899 L304* probably null Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Ppp1r12b A G 1: 134,892,270 V245A probably damaging Het
Rimbp3 G A 16: 17,210,427 V572I probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Syngr3 T C 17: 24,687,706 N45S probably benign Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Usf2 T C 7: 30,956,238 T1A probably null Het
Vill A T 9: 119,058,492 H108L probably benign Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Zfp24 AC A 18: 24,014,419 probably null Het
Other mutations in Ppp2r2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ppp2r2d APN 7 138882211 missense probably benign
IGL01538:Ppp2r2d APN 7 138876635 missense probably damaging 1.00
IGL02266:Ppp2r2d APN 7 138868437 missense probably damaging 0.97
IGL02268:Ppp2r2d APN 7 138872971 missense probably null 1.00
IGL03263:Ppp2r2d APN 7 138872922 nonsense probably null
R0482:Ppp2r2d UTSW 7 138870431 missense probably benign 0.08
R4043:Ppp2r2d UTSW 7 138882416 nonsense probably null
R4326:Ppp2r2d UTSW 7 138868485 missense probably damaging 1.00
R6164:Ppp2r2d UTSW 7 138873013 missense probably damaging 0.96
R7076:Ppp2r2d UTSW 7 138876597 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GGTTCTACCTTAGACCCATAAAGC -3'
(R):5'- TCCTCATCTACCAAGGTAGTGC -3'

Sequencing Primer
(F):5'- TTAGACCCATAAAGCAGACAAGAAG -3'
(R):5'- ACTGCAACAGGACTGAGT -3'
Posted On2014-08-01