Incidental Mutation 'R1946:Zfp24'
ID216721
Institutional Source Beutler Lab
Gene Symbol Zfp24
Ensembl Gene ENSMUSG00000051469
Gene Namezinc finger protein 24
SynonymsZF-12, Zfp191, KOX17, 3526401F17Rik, 5033419P20Rik
MMRRC Submission 039964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1946 (G1)
Quality Score113
Status Not validated
Chromosome18
Chromosomal Location24009702-24020810 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AC to A at 24014419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066497] [ENSMUST00000148525] [ENSMUST00000153337]
Predicted Effect probably null
Transcript: ENSMUST00000066497
SMART Domains Protein: ENSMUSP00000064637
Gene: ENSMUSG00000051469

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148525
Predicted Effect probably null
Transcript: ENSMUST00000153337
SMART Domains Protein: ENSMUSP00000122579
Gene: ENSMUSG00000051469

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for one mutation have hypomyelination of the central nervous system, tremors, tonic seizures and premature death, whereas mice homozygous null for another mutation are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adamts5 C A 16: 85,899,243 C342F probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Aen G C 7: 78,902,672 E32Q probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgap44 A G 11: 65,012,096 M509T probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
Bmpr2 T C 1: 59,868,397 V883A possibly damaging Het
Bpifa1 A T 2: 154,145,634 I135F probably damaging Het
Bsn A G 9: 108,114,651 F1301L probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Ccdc18 A G 5: 108,228,995 E1434G probably damaging Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Cpn1 G A 19: 43,956,518 T450M probably benign Het
Dlg4 A G 11: 70,039,575 Y432C probably damaging Het
Dnah8 C A 17: 30,712,385 T1458K probably benign Het
Dock5 A T 14: 67,786,316 M1132K probably damaging Het
Dsg2 A G 18: 20,580,548 D192G probably damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fndc11 A T 2: 181,221,834 D144V probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Ganab T A 19: 8,910,808 D439E probably damaging Het
Gm10228 C A 16: 89,041,353 G21V unknown Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gm9573 A T 17: 35,622,524 probably benign Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Gsdmc4 C A 15: 63,902,780 D51Y probably benign Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Kcnq2 T A 2: 181,088,451 D446V probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Lrrcc1 A G 3: 14,550,393 R394G probably benign Het
Lrrk2 G A 15: 91,736,661 probably null Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Msrb3 A G 10: 120,852,008 V54A probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Ncor2 G A 5: 125,034,412 T1314I probably damaging Het
Nes A G 3: 87,978,514 Q1316R possibly damaging Het
Nfe2l3 A C 6: 51,457,315 Q285P probably damaging Het
Nkd1 C T 8: 88,592,117 H357Y probably damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Olfr1333 T C 4: 118,830,026 N139S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr1469 T C 19: 13,410,779 V70A possibly damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Otx1 G T 11: 21,998,482 T46K probably damaging Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Pcdhb16 T A 18: 37,478,899 L304* probably null Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Ppp1r12b A G 1: 134,892,270 V245A probably damaging Het
Ppp2r2d A G 7: 138,868,467 D19G probably damaging Het
Rimbp3 G A 16: 17,210,427 V572I probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Syngr3 T C 17: 24,687,706 N45S probably benign Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Usf2 T C 7: 30,956,238 T1A probably null Het
Vill A T 9: 119,058,492 H108L probably benign Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Zfp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02750:Zfp24 APN 18 24017353 missense possibly damaging 0.48
R1573:Zfp24 UTSW 18 24017342 missense possibly damaging 0.70
R2508:Zfp24 UTSW 18 24017870 missense probably damaging 1.00
R2845:Zfp24 UTSW 18 24017828 missense probably damaging 0.99
R4119:Zfp24 UTSW 18 24014569 missense possibly damaging 0.86
R4471:Zfp24 UTSW 18 24018115 start gained probably benign
R5847:Zfp24 UTSW 18 24018038 missense possibly damaging 0.93
R6091:Zfp24 UTSW 18 24014212 missense probably damaging 1.00
R6659:Zfp24 UTSW 18 24017334 missense possibly damaging 0.61
Y4338:Zfp24 UTSW 18 24017855 missense possibly damaging 0.55
Y4338:Zfp24 UTSW 18 24017868 missense probably damaging 1.00
Y5409:Zfp24 UTSW 18 24017855 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CTGAAGAGGTTTGAGCTCTGAC -3'
(R):5'- CTCAACATAGGTGTTCCCCAGC -3'

Sequencing Primer
(F):5'- GACTGTAGGATTTCCCACACTG -3'
(R):5'- GTTCCCCAGCTTTTTAAATATGGAG -3'
Posted On2014-08-01