Incidental Mutation 'R0132:Srrm1'
ID21683
Institutional Source Beutler Lab
Gene Symbol Srrm1
Ensembl Gene ENSMUSG00000028809
Gene Nameserine/arginine repetitive matrix 1
SynonymsSRm160
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0132 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location135320484-135353321 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 135340573 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 322 (R322*)
Ref Sequence ENSEMBL: ENSMUSP00000125003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030613] [ENSMUST00000084846] [ENSMUST00000105861] [ENSMUST00000131373] [ENSMUST00000136342] [ENSMUST00000136409]
Predicted Effect probably null
Transcript: ENSMUST00000030613
AA Change: R322*
SMART Domains Protein: ENSMUSP00000030613
Gene: ENSMUSG00000028809
AA Change: R322*

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 4.31e-5 PROSPERO
internal_repeat_1 427 456 3.46e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 3.46e-6 PROSPERO
internal_repeat_3 670 693 4.31e-5 PROSPERO
internal_repeat_4 684 698 4.31e-5 PROSPERO
internal_repeat_2 689 734 4.31e-5 PROSPERO
internal_repeat_3 719 740 4.31e-5 PROSPERO
internal_repeat_5 730 740 8.09e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 4.31e-5 PROSPERO
internal_repeat_5 808 818 8.09e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 886 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084846
AA Change: R317*
SMART Domains Protein: ENSMUSP00000081906
Gene: ENSMUSG00000028809
AA Change: R317*

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 402 N/A INTRINSIC
internal_repeat_2 404 450 3.57e-5 PROSPERO
internal_repeat_1 422 451 2.79e-6 PROSPERO
low complexity region 471 495 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 550 656 N/A INTRINSIC
internal_repeat_1 661 695 2.79e-6 PROSPERO
internal_repeat_3 665 688 3.57e-5 PROSPERO
internal_repeat_4 679 693 3.57e-5 PROSPERO
internal_repeat_2 684 729 3.57e-5 PROSPERO
internal_repeat_3 714 735 3.57e-5 PROSPERO
internal_repeat_5 725 735 6.75e-5 PROSPERO
low complexity region 741 790 N/A INTRINSIC
internal_repeat_4 794 808 3.57e-5 PROSPERO
internal_repeat_5 803 813 6.75e-5 PROSPERO
low complexity region 822 846 N/A INTRINSIC
low complexity region 849 886 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105861
AA Change: R322*
SMART Domains Protein: ENSMUSP00000101487
Gene: ENSMUSG00000028809
AA Change: R322*

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 1.99e-5 PROSPERO
internal_repeat_1 427 456 1.45e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 539 647 N/A INTRINSIC
internal_repeat_1 652 686 1.45e-6 PROSPERO
internal_repeat_3 656 679 1.99e-5 PROSPERO
internal_repeat_4 670 684 1.99e-5 PROSPERO
internal_repeat_2 675 720 1.99e-5 PROSPERO
internal_repeat_3 705 726 1.99e-5 PROSPERO
internal_repeat_5 716 726 3.82e-5 PROSPERO
low complexity region 732 781 N/A INTRINSIC
internal_repeat_4 785 799 1.99e-5 PROSPERO
internal_repeat_5 794 804 3.82e-5 PROSPERO
low complexity region 813 837 N/A INTRINSIC
low complexity region 840 877 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131301
AA Change: R111*
SMART Domains Protein: ENSMUSP00000125477
Gene: ENSMUSG00000028809
AA Change: R111*

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 38 61 N/A INTRINSIC
low complexity region 63 135 N/A INTRINSIC
internal_repeat_1 182 196 7.32e-5 PROSPERO
internal_repeat_1 195 209 7.32e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000131373
SMART Domains Protein: ENSMUSP00000122754
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 145 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134854
Predicted Effect probably null
Transcript: ENSMUST00000136342
AA Change: R322*
SMART Domains Protein: ENSMUSP00000125003
Gene: ENSMUSG00000028809
AA Change: R322*

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 3.36e-5 PROSPERO
internal_repeat_1 427 456 2.61e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 2.61e-6 PROSPERO
internal_repeat_3 670 693 3.36e-5 PROSPERO
internal_repeat_4 684 698 3.36e-5 PROSPERO
internal_repeat_2 689 734 3.36e-5 PROSPERO
internal_repeat_3 719 740 3.36e-5 PROSPERO
internal_repeat_5 730 740 6.37e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 3.36e-5 PROSPERO
internal_repeat_5 808 818 6.37e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 891 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136409
SMART Domains Protein: ENSMUSP00000124450
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:PWI 38 95 4.4e-17 PFAM
low complexity region 119 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154788
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Srrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Srrm1 APN 4 135347207 splice site probably null
IGL02070:Srrm1 APN 4 135325104 missense unknown
IGL02073:Srrm1 APN 4 135325104 missense unknown
IGL02193:Srrm1 APN 4 135325104 missense unknown
IGL02232:Srrm1 APN 4 135353116 start codon destroyed probably null 1.00
IGL02377:Srrm1 APN 4 135325104 missense unknown
IGL02379:Srrm1 APN 4 135325104 missense unknown
IGL02380:Srrm1 APN 4 135325104 missense unknown
IGL02382:Srrm1 APN 4 135325104 missense unknown
IGL02386:Srrm1 APN 4 135325104 missense unknown
IGL02387:Srrm1 APN 4 135325104 missense unknown
IGL02393:Srrm1 APN 4 135321414 unclassified probably benign
IGL02436:Srrm1 APN 4 135325104 missense unknown
IGL02438:Srrm1 APN 4 135325104 missense unknown
IGL02439:Srrm1 APN 4 135325104 missense unknown
IGL02440:Srrm1 APN 4 135325104 missense unknown
IGL02500:Srrm1 APN 4 135325104 missense unknown
IGL02561:Srrm1 APN 4 135325104 missense unknown
IGL02562:Srrm1 APN 4 135325104 missense unknown
IGL02566:Srrm1 APN 4 135325104 missense unknown
IGL02567:Srrm1 APN 4 135325104 missense unknown
IGL02568:Srrm1 APN 4 135325104 missense unknown
IGL02569:Srrm1 APN 4 135325104 missense unknown
IGL02570:Srrm1 APN 4 135325104 missense unknown
IGL02572:Srrm1 APN 4 135325104 missense unknown
IGL02583:Srrm1 APN 4 135325104 missense unknown
IGL02584:Srrm1 APN 4 135325104 missense unknown
IGL02585:Srrm1 APN 4 135325104 missense unknown
IGL02586:Srrm1 APN 4 135325104 missense unknown
IGL02587:Srrm1 APN 4 135325104 missense unknown
IGL02588:Srrm1 APN 4 135325104 missense unknown
IGL02589:Srrm1 APN 4 135325104 missense unknown
IGL02596:Srrm1 APN 4 135325104 missense unknown
IGL02597:Srrm1 APN 4 135325104 missense unknown
IGL02601:Srrm1 APN 4 135325104 missense unknown
IGL02602:Srrm1 APN 4 135325104 missense unknown
IGL02609:Srrm1 APN 4 135325104 missense unknown
IGL02614:Srrm1 APN 4 135325104 missense unknown
IGL02631:Srrm1 APN 4 135325104 missense unknown
IGL02632:Srrm1 APN 4 135325104 missense unknown
IGL02657:Srrm1 APN 4 135325104 missense unknown
IGL02658:Srrm1 APN 4 135325104 missense unknown
IGL02659:Srrm1 APN 4 135325104 missense unknown
IGL02660:Srrm1 APN 4 135325104 missense unknown
IGL02677:Srrm1 APN 4 135325104 missense unknown
IGL02683:Srrm1 APN 4 135325104 missense unknown
IGL02686:Srrm1 APN 4 135325104 missense unknown
IGL02690:Srrm1 APN 4 135325104 missense unknown
IGL02713:Srrm1 APN 4 135325104 missense unknown
IGL02723:Srrm1 APN 4 135325104 missense unknown
IGL02724:Srrm1 APN 4 135325104 missense unknown
IGL02725:Srrm1 APN 4 135325104 missense unknown
IGL02730:Srrm1 APN 4 135325104 missense unknown
IGL02731:Srrm1 APN 4 135325104 missense unknown
IGL02732:Srrm1 APN 4 135325104 missense unknown
IGL02733:Srrm1 APN 4 135325104 missense unknown
IGL02734:Srrm1 APN 4 135325104 missense unknown
IGL02743:Srrm1 APN 4 135325104 missense unknown
IGL02744:Srrm1 APN 4 135325104 missense unknown
IGL02752:Srrm1 APN 4 135325104 missense unknown
Serious UTSW 4 135340926 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0510:Srrm1 UTSW 4 135338543 intron probably benign
R0691:Srrm1 UTSW 4 135324991 nonsense probably null
R1337:Srrm1 UTSW 4 135346733 critical splice donor site probably null
R1397:Srrm1 UTSW 4 135321431 unclassified probably benign
R2883:Srrm1 UTSW 4 135321411 unclassified probably benign
R4043:Srrm1 UTSW 4 135340931 unclassified probably benign
R4772:Srrm1 UTSW 4 135342379 unclassified probably benign
R4837:Srrm1 UTSW 4 135345512 intron probably benign
R4975:Srrm1 UTSW 4 135346720 splice site probably benign
R5401:Srrm1 UTSW 4 135324069 splice site probably benign
R6144:Srrm1 UTSW 4 135337873 unclassified probably benign
R6542:Srrm1 UTSW 4 135340926 nonsense probably null
R7147:Srrm1 UTSW 4 135346826 missense probably damaging 0.98
R7211:Srrm1 UTSW 4 135327128 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CGTGAGGAATGCATCAGATCAGGC -3'
(R):5'- ACGGAGACATAGATCCCGATCAAGG -3'

Sequencing Primer
(F):5'- ATGCATCAGATCAGGCTACTTCG -3'
(R):5'- ATCCCGATCAAGGTGCGTTG -3'
Posted On2013-04-11