Incidental Mutation 'R1962:Nrp2'
ID216930
Institutional Source Beutler Lab
Gene Symbol Nrp2
Ensembl Gene ENSMUSG00000025969
Gene Nameneuropilin 2
SynonymsNpn2, NP-2, NP2, Npn-2, 1110048P06Rik
MMRRC Submission 039976-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R1962 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location62703285-62818695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62718931 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 25 (D25E)
Ref Sequence ENSEMBL: ENSMUSP00000109794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]
Predicted Effect probably benign
Transcript: ENSMUST00000027112
AA Change: D25E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: D25E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 1.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063594
AA Change: D25E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: D25E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 816 831 N/A INTRINSIC
Pfam:DUF3481 839 923 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075144
AA Change: D25E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: D25E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 827 911 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102822
AA Change: D25E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: D25E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114155
AA Change: D25E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: D25E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 817 901 9.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114157
AA Change: D25E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: D25E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 821 836 N/A INTRINSIC
Pfam:DUF3481 844 928 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189205
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,341,245 I354M probably damaging Het
Abca8a T C 11: 110,026,905 probably null Het
Abca8b T C 11: 109,979,898 R143G probably benign Het
Actn4 T C 7: 28,894,622 D840G probably damaging Het
Agpat5 T C 8: 18,878,010 L197P probably damaging Het
Akr1d1 T C 6: 37,536,048 V93A probably benign Het
Arap2 T C 5: 62,676,664 K820R possibly damaging Het
Armc9 T A 1: 86,207,974 C551S probably damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Brms1 C T 19: 5,045,999 R34W probably damaging Het
Cbx2 A G 11: 119,028,569 Q320R possibly damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Ccdc30 C T 4: 119,339,791 R426Q probably benign Het
Cdc42bpg T A 19: 6,306,855 V47E probably damaging Het
Cep170b C T 12: 112,738,061 S751L probably damaging Het
Cfap46 A T 7: 139,667,041 L328Q probably damaging Het
Crtc3 A G 7: 80,589,931 F558L probably damaging Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
Dchs1 A G 7: 105,764,201 Y1136H probably damaging Het
Dhrs4 T C 14: 55,487,603 V185A probably damaging Het
Dnah7b A G 1: 46,242,103 K2775E possibly damaging Het
Dst C A 1: 34,191,016 S2238R possibly damaging Het
Duox2 T C 2: 122,297,372 probably null Het
Dusp16 G T 6: 134,718,136 Y577* probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eml5 A G 12: 98,876,311 F176S probably damaging Het
Esco2 C A 14: 65,831,533 R109S probably damaging Het
Galnt7 C T 8: 57,532,714 E541K probably benign Het
Gbf1 C T 19: 46,267,219 T707I probably damaging Het
Gdf5 A G 2: 155,941,752 C427R probably damaging Het
Glyctk T C 9: 106,157,865 M1V probably null Het
Gm5478 T C 15: 101,644,395 E367G probably damaging Het
Gm9268 T C 7: 43,047,400 V620A probably benign Het
Golga7b G A 19: 42,263,329 V5I probably benign Het
Gpt2 T C 8: 85,493,135 L70P probably damaging Het
Gsdmc3 C A 15: 63,858,466 Q416H probably damaging Het
Hoxb5 A G 11: 96,304,092 E160G probably benign Het
Ift81 A T 5: 122,560,709 Y532N probably benign Het
Igf1 G A 10: 87,864,864 C66Y probably damaging Het
Igf1r T C 7: 68,207,275 V995A probably damaging Het
Ip6k1 T C 9: 108,041,088 probably null Het
Jaml T C 9: 45,104,197 I333T possibly damaging Het
Kdm4c T C 4: 74,307,016 probably benign Het
Kdm6b T C 11: 69,401,365 probably benign Het
Krt6a C T 15: 101,691,465 R404H probably damaging Het
Larp4b C A 13: 9,136,842 H69N probably benign Het
Lcat A T 8: 105,941,723 W222R probably damaging Het
Lrrc40 T A 3: 158,040,449 C54S probably benign Het
Mcpt9 T A 14: 56,027,567 H159L probably benign Het
Megf8 T C 7: 25,363,551 V2444A probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Micalcl A T 7: 112,412,844 I634L probably benign Het
Mov10 C T 3: 104,796,977 R835Q probably damaging Het
Mybpc1 A T 10: 88,548,826 L546Q probably damaging Het
Myo6 T C 9: 80,260,835 V427A probably damaging Het
Myom2 T A 8: 15,132,599 probably null Het
Mzt2 G A 16: 15,848,679 R125C probably damaging Het
Neb T A 2: 52,272,937 R2031* probably null Het
Nphp3 T C 9: 104,021,338 S447P probably benign Het
Nts A G 10: 102,485,057 L57S probably damaging Het
Nudt9 G A 5: 104,065,105 R348H probably benign Het
Olfr1299 T C 2: 111,664,889 I221T probably damaging Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Olfr211 C T 6: 116,493,764 P52S probably benign Het
Olfr401 C A 11: 74,121,824 D178E probably benign Het
Olfr976 T C 9: 39,956,683 Y84C probably benign Het
Pafah1b1 T C 11: 74,699,351 probably benign Het
Piezo2 C A 18: 63,078,840 M1291I probably damaging Het
Pik3ca T C 3: 32,443,867 F486S probably benign Het
Podnl1 C T 8: 84,127,297 H99Y probably benign Het
Prdm6 A T 18: 53,568,161 Y341F probably damaging Het
Prr5l C T 2: 101,758,509 probably null Het
Psmd4 G T 3: 95,036,701 T24N possibly damaging Het
Rbbp8nl G A 2: 180,280,874 T242M probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Scfd1 T C 12: 51,422,986 V438A probably benign Het
Scn9a A G 2: 66,484,311 C1677R probably damaging Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Shank1 T A 7: 44,344,323 probably null Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Sncaip C T 18: 52,871,362 H354Y probably damaging Het
St8sia2 T A 7: 73,943,309 D333V probably damaging Het
Stxbp2 C A 8: 3,642,672 R575S probably benign Het
Syt9 T A 7: 107,425,107 V69D probably damaging Het
Tanc2 A G 11: 105,798,732 N240S probably benign Het
Tcl1b1 T C 12: 105,164,468 L70S probably benign Het
Tmem44 C T 16: 30,543,401 probably null Het
Tor1b A G 2: 30,956,919 R293G probably benign Het
Trim29 T C 9: 43,311,318 V148A probably benign Het
Trmt10b C A 4: 45,314,378 Y271* probably null Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Ubqln5 T C 7: 104,128,927 D230G probably damaging Het
Ugt2b37 A G 5: 87,254,334 F146S probably damaging Het
Vmn1r160 T A 7: 22,871,402 V60E probably damaging Het
Vmn2r109 T A 17: 20,553,923 D390V probably damaging Het
Vmn2r27 C T 6: 124,223,834 R388Q possibly damaging Het
Vmn2r72 A T 7: 85,749,161 V537D probably benign Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Vmn2r98 C A 17: 19,065,333 Y138* probably null Het
Xrra1 A C 7: 99,911,020 E401A probably damaging Het
Zfp280d T A 9: 72,335,080 C688* probably null Het
Zfp3 T A 11: 70,772,128 Y304* probably null Het
Zfp407 A T 18: 84,559,336 D1217E probably benign Het
Zfp658 T C 7: 43,573,821 Y507H possibly damaging Het
Zfyve16 T C 13: 92,522,744 T220A possibly damaging Het
Zmym4 C G 4: 126,902,670 K820N possibly damaging Het
Other mutations in Nrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Nrp2 APN 1 62704251 nonsense probably null
IGL01912:Nrp2 APN 1 62771737 missense probably damaging 1.00
IGL01996:Nrp2 APN 1 62749260 missense probably damaging 1.00
IGL02184:Nrp2 APN 1 62718940 nonsense probably null
IGL02682:Nrp2 APN 1 62771837 missense probably benign 0.03
IGL02928:Nrp2 APN 1 62815446 missense probably damaging 1.00
IGL03024:Nrp2 APN 1 62771734 missense probably damaging 1.00
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0683:Nrp2 UTSW 1 62744318 missense probably benign 0.41
R0789:Nrp2 UTSW 1 62745450 missense probably benign 0.44
R1418:Nrp2 UTSW 1 62783332 nonsense probably null
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1544:Nrp2 UTSW 1 62762904 missense probably damaging 1.00
R1645:Nrp2 UTSW 1 62785124 missense probably damaging 0.97
R1677:Nrp2 UTSW 1 62783320 missense probably benign 0.18
R1752:Nrp2 UTSW 1 62738441 missense probably damaging 1.00
R1840:Nrp2 UTSW 1 62738339 missense probably damaging 1.00
R1916:Nrp2 UTSW 1 62762747 missense probably damaging 1.00
R2108:Nrp2 UTSW 1 62744277 missense probably damaging 1.00
R2164:Nrp2 UTSW 1 62744355 missense probably damaging 1.00
R2216:Nrp2 UTSW 1 62762918 nonsense probably null
R2679:Nrp2 UTSW 1 62785078 missense probably benign 0.00
R4349:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4351:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4352:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4353:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4811:Nrp2 UTSW 1 62719081 missense probably damaging 1.00
R5362:Nrp2 UTSW 1 62769062 missense probably benign 0.01
R5387:Nrp2 UTSW 1 62762813 missense probably benign 0.02
R5461:Nrp2 UTSW 1 62747211 nonsense probably null
R5704:Nrp2 UTSW 1 62785108 missense probably benign 0.00
R6143:Nrp2 UTSW 1 62760815 missense probably damaging 1.00
R6303:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6304:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6376:Nrp2 UTSW 1 62719017 missense possibly damaging 0.65
R6945:Nrp2 UTSW 1 62760788 missense probably damaging 1.00
R7347:Nrp2 UTSW 1 62745504 missense probably benign 0.04
R7393:Nrp2 UTSW 1 62745424 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGGAGTCTTAAGTGTGCACTCT -3'
(R):5'- TGCCCTTCAGTGAGAGAAAGG -3'

Sequencing Primer
(F):5'- AGTGTGCACTCTTGTTTTCATAATC -3'
(R):5'- CAGAATATCAGAGCAGTGGCCC -3'
Posted On2014-08-01