Incidental Mutation 'R1962:Igf1'
ID217006
Institutional Source Beutler Lab
Gene Symbol Igf1
Ensembl Gene ENSMUSG00000020053
Gene Nameinsulin-like growth factor 1
SynonymsC730016P09Rik, Igf-I, Igf-1
MMRRC Submission 039976-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1962 (G1)
Quality Score197
Status Not validated
Chromosome10
Chromosomal Location87858265-87937042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87864864 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 66 (C66Y)
Ref Sequence ENSEMBL: ENSMUSP00000113905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062862] [ENSMUST00000095360] [ENSMUST00000105300] [ENSMUST00000121161] [ENSMUST00000121952] [ENSMUST00000122100] [ENSMUST00000122386] [ENSMUST00000126490]
Predicted Effect probably damaging
Transcript: ENSMUST00000062862
AA Change: C50Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056668
Gene: ENSMUSG00000020053
AA Change: C50Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095360
AA Change: C66Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093005
Gene: ENSMUSG00000020053
AA Change: C66Y

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105300
AA Change: C66Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100937
Gene: ENSMUSG00000020053
AA Change: C66Y

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121161
AA Change: C50Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114120
Gene: ENSMUSG00000020053
AA Change: C50Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121952
AA Change: C50Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113177
Gene: ENSMUSG00000020053
AA Change: C50Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122100
AA Change: C50Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112878
Gene: ENSMUSG00000020053
AA Change: C50Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122386
AA Change: C66Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113905
Gene: ENSMUSG00000020053
AA Change: C66Y

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126490
AA Change: C50Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122188
Gene: ENSMUSG00000020053
AA Change: C50Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146581
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are severely growth retarded and die perinatally with many immature organ systems. Heterozygotes and partial knockouts show genetic background effects and can display growth retardation and abnormalities in muscle, lungs, and CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,341,245 I354M probably damaging Het
Abca8a T C 11: 110,026,905 probably null Het
Abca8b T C 11: 109,979,898 R143G probably benign Het
Actn4 T C 7: 28,894,622 D840G probably damaging Het
Agpat5 T C 8: 18,878,010 L197P probably damaging Het
Akr1d1 T C 6: 37,536,048 V93A probably benign Het
Arap2 T C 5: 62,676,664 K820R possibly damaging Het
Armc9 T A 1: 86,207,974 C551S probably damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Brms1 C T 19: 5,045,999 R34W probably damaging Het
Cbx2 A G 11: 119,028,569 Q320R possibly damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Ccdc30 C T 4: 119,339,791 R426Q probably benign Het
Cdc42bpg T A 19: 6,306,855 V47E probably damaging Het
Cep170b C T 12: 112,738,061 S751L probably damaging Het
Cfap46 A T 7: 139,667,041 L328Q probably damaging Het
Crtc3 A G 7: 80,589,931 F558L probably damaging Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
Dchs1 A G 7: 105,764,201 Y1136H probably damaging Het
Dhrs4 T C 14: 55,487,603 V185A probably damaging Het
Dnah7b A G 1: 46,242,103 K2775E possibly damaging Het
Dst C A 1: 34,191,016 S2238R possibly damaging Het
Duox2 T C 2: 122,297,372 probably null Het
Dusp16 G T 6: 134,718,136 Y577* probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eml5 A G 12: 98,876,311 F176S probably damaging Het
Esco2 C A 14: 65,831,533 R109S probably damaging Het
Galnt7 C T 8: 57,532,714 E541K probably benign Het
Gbf1 C T 19: 46,267,219 T707I probably damaging Het
Gdf5 A G 2: 155,941,752 C427R probably damaging Het
Glyctk T C 9: 106,157,865 M1V probably null Het
Gm5478 T C 15: 101,644,395 E367G probably damaging Het
Gm9268 T C 7: 43,047,400 V620A probably benign Het
Golga7b G A 19: 42,263,329 V5I probably benign Het
Gpt2 T C 8: 85,493,135 L70P probably damaging Het
Gsdmc3 C A 15: 63,858,466 Q416H probably damaging Het
Hoxb5 A G 11: 96,304,092 E160G probably benign Het
Ift81 A T 5: 122,560,709 Y532N probably benign Het
Igf1r T C 7: 68,207,275 V995A probably damaging Het
Ip6k1 T C 9: 108,041,088 probably null Het
Jaml T C 9: 45,104,197 I333T possibly damaging Het
Kdm4c T C 4: 74,307,016 probably benign Het
Kdm6b T C 11: 69,401,365 probably benign Het
Krt6a C T 15: 101,691,465 R404H probably damaging Het
Larp4b C A 13: 9,136,842 H69N probably benign Het
Lcat A T 8: 105,941,723 W222R probably damaging Het
Lrrc40 T A 3: 158,040,449 C54S probably benign Het
Mcpt9 T A 14: 56,027,567 H159L probably benign Het
Megf8 T C 7: 25,363,551 V2444A probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Micalcl A T 7: 112,412,844 I634L probably benign Het
Mov10 C T 3: 104,796,977 R835Q probably damaging Het
Mybpc1 A T 10: 88,548,826 L546Q probably damaging Het
Myo6 T C 9: 80,260,835 V427A probably damaging Het
Myom2 T A 8: 15,132,599 probably null Het
Mzt2 G A 16: 15,848,679 R125C probably damaging Het
Neb T A 2: 52,272,937 R2031* probably null Het
Nphp3 T C 9: 104,021,338 S447P probably benign Het
Nrp2 T A 1: 62,718,931 D25E probably benign Het
Nts A G 10: 102,485,057 L57S probably damaging Het
Nudt9 G A 5: 104,065,105 R348H probably benign Het
Olfr1299 T C 2: 111,664,889 I221T probably damaging Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Olfr211 C T 6: 116,493,764 P52S probably benign Het
Olfr401 C A 11: 74,121,824 D178E probably benign Het
Olfr976 T C 9: 39,956,683 Y84C probably benign Het
Pafah1b1 T C 11: 74,699,351 probably benign Het
Piezo2 C A 18: 63,078,840 M1291I probably damaging Het
Pik3ca T C 3: 32,443,867 F486S probably benign Het
Podnl1 C T 8: 84,127,297 H99Y probably benign Het
Prdm6 A T 18: 53,568,161 Y341F probably damaging Het
Prr5l C T 2: 101,758,509 probably null Het
Psmd4 G T 3: 95,036,701 T24N possibly damaging Het
Rbbp8nl G A 2: 180,280,874 T242M probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Scfd1 T C 12: 51,422,986 V438A probably benign Het
Scn9a A G 2: 66,484,311 C1677R probably damaging Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Shank1 T A 7: 44,344,323 probably null Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Sncaip C T 18: 52,871,362 H354Y probably damaging Het
St8sia2 T A 7: 73,943,309 D333V probably damaging Het
Stxbp2 C A 8: 3,642,672 R575S probably benign Het
Syt9 T A 7: 107,425,107 V69D probably damaging Het
Tanc2 A G 11: 105,798,732 N240S probably benign Het
Tcl1b1 T C 12: 105,164,468 L70S probably benign Het
Tmem44 C T 16: 30,543,401 probably null Het
Tor1b A G 2: 30,956,919 R293G probably benign Het
Trim29 T C 9: 43,311,318 V148A probably benign Het
Trmt10b C A 4: 45,314,378 Y271* probably null Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Ubqln5 T C 7: 104,128,927 D230G probably damaging Het
Ugt2b37 A G 5: 87,254,334 F146S probably damaging Het
Vmn1r160 T A 7: 22,871,402 V60E probably damaging Het
Vmn2r109 T A 17: 20,553,923 D390V probably damaging Het
Vmn2r27 C T 6: 124,223,834 R388Q possibly damaging Het
Vmn2r72 A T 7: 85,749,161 V537D probably benign Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Vmn2r98 C A 17: 19,065,333 Y138* probably null Het
Xrra1 A C 7: 99,911,020 E401A probably damaging Het
Zfp280d T A 9: 72,335,080 C688* probably null Het
Zfp3 T A 11: 70,772,128 Y304* probably null Het
Zfp407 A T 18: 84,559,336 D1217E probably benign Het
Zfp658 T C 7: 43,573,821 Y507H possibly damaging Het
Zfyve16 T C 13: 92,522,744 T220A possibly damaging Het
Zmym4 C G 4: 126,902,670 K820N possibly damaging Het
Other mutations in Igf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02485:Igf1 APN 10 87864746 missense probably benign
IGL03171:Igf1 APN 10 87864821 missense probably damaging 1.00
R1850:Igf1 UTSW 10 87861374 missense possibly damaging 0.47
R2428:Igf1 UTSW 10 87864821 missense probably damaging 1.00
R3852:Igf1 UTSW 10 87915319 nonsense probably null
R4757:Igf1 UTSW 10 87915425 missense probably benign 0.01
R6893:Igf1 UTSW 10 87864860 missense probably damaging 1.00
R6954:Igf1 UTSW 10 87864860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCCAGAAGGATACCTG -3'
(R):5'- ATGCCCCACTGAAGTGTTATGC -3'

Sequencing Primer
(F):5'- CAGAAGGATACCTGAACCTCC -3'
(R):5'- TGCATACATTAAGGTGATGGATATGG -3'
Posted On2014-08-01