Incidental Mutation 'R1962:Larp4b'
ID217025
Institutional Source Beutler Lab
Gene Symbol Larp4b
Ensembl Gene ENSMUSG00000033499
Gene NameLa ribonucleoprotein domain family, member 4B
SynonymsLarp5, D13Wsu64e
MMRRC Submission 039976-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R1962 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location9093881-9174451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 9136842 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 69 (H69N)
Ref Sequence ENSEMBL: ENSMUSP00000139578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091829] [ENSMUST00000188211] [ENSMUST00000188939]
Predicted Effect probably benign
Transcript: ENSMUST00000091829
AA Change: H69N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089437
Gene: ENSMUSG00000033499
AA Change: H69N

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188211
AA Change: H69N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140993
Gene: ENSMUSG00000033499
AA Change: H69N

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188523
Predicted Effect probably benign
Transcript: ENSMUST00000188939
AA Change: H69N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139578
Gene: ENSMUSG00000033499
AA Change: H69N

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191066
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved protein family implicated in RNA metabolism and translation. Members of this family are characterized by the presence of an La motif, which is often located adjacent to one or more RNA recognition motifs (RRM). Together, the two motifs constitute the functional region of the protein and enable its interaction with the RNA substrate. This protein family is divided into five sub-families: the genuine La proteins and four La-related protein (LARP) sub-families. The protein encoded by this gene belongs to LARP sub-family 4. It is a cytoplasmic protein that may play a stimulatory role in translation. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,341,245 I354M probably damaging Het
Abca8a T C 11: 110,026,905 probably null Het
Abca8b T C 11: 109,979,898 R143G probably benign Het
Actn4 T C 7: 28,894,622 D840G probably damaging Het
Agpat5 T C 8: 18,878,010 L197P probably damaging Het
Akr1d1 T C 6: 37,536,048 V93A probably benign Het
Arap2 T C 5: 62,676,664 K820R possibly damaging Het
Armc9 T A 1: 86,207,974 C551S probably damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Brms1 C T 19: 5,045,999 R34W probably damaging Het
Cbx2 A G 11: 119,028,569 Q320R possibly damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Ccdc30 C T 4: 119,339,791 R426Q probably benign Het
Cdc42bpg T A 19: 6,306,855 V47E probably damaging Het
Cep170b C T 12: 112,738,061 S751L probably damaging Het
Cfap46 A T 7: 139,667,041 L328Q probably damaging Het
Crtc3 A G 7: 80,589,931 F558L probably damaging Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
Dchs1 A G 7: 105,764,201 Y1136H probably damaging Het
Dhrs4 T C 14: 55,487,603 V185A probably damaging Het
Dnah7b A G 1: 46,242,103 K2775E possibly damaging Het
Dst C A 1: 34,191,016 S2238R possibly damaging Het
Duox2 T C 2: 122,297,372 probably null Het
Dusp16 G T 6: 134,718,136 Y577* probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eml5 A G 12: 98,876,311 F176S probably damaging Het
Esco2 C A 14: 65,831,533 R109S probably damaging Het
Galnt7 C T 8: 57,532,714 E541K probably benign Het
Gbf1 C T 19: 46,267,219 T707I probably damaging Het
Gdf5 A G 2: 155,941,752 C427R probably damaging Het
Glyctk T C 9: 106,157,865 M1V probably null Het
Gm5478 T C 15: 101,644,395 E367G probably damaging Het
Gm9268 T C 7: 43,047,400 V620A probably benign Het
Golga7b G A 19: 42,263,329 V5I probably benign Het
Gpt2 T C 8: 85,493,135 L70P probably damaging Het
Gsdmc3 C A 15: 63,858,466 Q416H probably damaging Het
Hoxb5 A G 11: 96,304,092 E160G probably benign Het
Ift81 A T 5: 122,560,709 Y532N probably benign Het
Igf1 G A 10: 87,864,864 C66Y probably damaging Het
Igf1r T C 7: 68,207,275 V995A probably damaging Het
Ip6k1 T C 9: 108,041,088 probably null Het
Jaml T C 9: 45,104,197 I333T possibly damaging Het
Kdm4c T C 4: 74,307,016 probably benign Het
Kdm6b T C 11: 69,401,365 probably benign Het
Krt6a C T 15: 101,691,465 R404H probably damaging Het
Lcat A T 8: 105,941,723 W222R probably damaging Het
Lrrc40 T A 3: 158,040,449 C54S probably benign Het
Mcpt9 T A 14: 56,027,567 H159L probably benign Het
Megf8 T C 7: 25,363,551 V2444A probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Micalcl A T 7: 112,412,844 I634L probably benign Het
Mov10 C T 3: 104,796,977 R835Q probably damaging Het
Mybpc1 A T 10: 88,548,826 L546Q probably damaging Het
Myo6 T C 9: 80,260,835 V427A probably damaging Het
Myom2 T A 8: 15,132,599 probably null Het
Mzt2 G A 16: 15,848,679 R125C probably damaging Het
Neb T A 2: 52,272,937 R2031* probably null Het
Nphp3 T C 9: 104,021,338 S447P probably benign Het
Nrp2 T A 1: 62,718,931 D25E probably benign Het
Nts A G 10: 102,485,057 L57S probably damaging Het
Nudt9 G A 5: 104,065,105 R348H probably benign Het
Olfr1299 T C 2: 111,664,889 I221T probably damaging Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Olfr211 C T 6: 116,493,764 P52S probably benign Het
Olfr401 C A 11: 74,121,824 D178E probably benign Het
Olfr976 T C 9: 39,956,683 Y84C probably benign Het
Pafah1b1 T C 11: 74,699,351 probably benign Het
Piezo2 C A 18: 63,078,840 M1291I probably damaging Het
Pik3ca T C 3: 32,443,867 F486S probably benign Het
Podnl1 C T 8: 84,127,297 H99Y probably benign Het
Prdm6 A T 18: 53,568,161 Y341F probably damaging Het
Prr5l C T 2: 101,758,509 probably null Het
Psmd4 G T 3: 95,036,701 T24N possibly damaging Het
Rbbp8nl G A 2: 180,280,874 T242M probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Scfd1 T C 12: 51,422,986 V438A probably benign Het
Scn9a A G 2: 66,484,311 C1677R probably damaging Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Shank1 T A 7: 44,344,323 probably null Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Sncaip C T 18: 52,871,362 H354Y probably damaging Het
St8sia2 T A 7: 73,943,309 D333V probably damaging Het
Stxbp2 C A 8: 3,642,672 R575S probably benign Het
Syt9 T A 7: 107,425,107 V69D probably damaging Het
Tanc2 A G 11: 105,798,732 N240S probably benign Het
Tcl1b1 T C 12: 105,164,468 L70S probably benign Het
Tmem44 C T 16: 30,543,401 probably null Het
Tor1b A G 2: 30,956,919 R293G probably benign Het
Trim29 T C 9: 43,311,318 V148A probably benign Het
Trmt10b C A 4: 45,314,378 Y271* probably null Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Ubqln5 T C 7: 104,128,927 D230G probably damaging Het
Ugt2b37 A G 5: 87,254,334 F146S probably damaging Het
Vmn1r160 T A 7: 22,871,402 V60E probably damaging Het
Vmn2r109 T A 17: 20,553,923 D390V probably damaging Het
Vmn2r27 C T 6: 124,223,834 R388Q possibly damaging Het
Vmn2r72 A T 7: 85,749,161 V537D probably benign Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Vmn2r98 C A 17: 19,065,333 Y138* probably null Het
Xrra1 A C 7: 99,911,020 E401A probably damaging Het
Zfp280d T A 9: 72,335,080 C688* probably null Het
Zfp3 T A 11: 70,772,128 Y304* probably null Het
Zfp407 A T 18: 84,559,336 D1217E probably benign Het
Zfp658 T C 7: 43,573,821 Y507H possibly damaging Het
Zfyve16 T C 13: 92,522,744 T220A possibly damaging Het
Zmym4 C G 4: 126,902,670 K820N possibly damaging Het
Other mutations in Larp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Larp4b APN 13 9158124 missense probably damaging 0.99
IGL02519:Larp4b APN 13 9158580 missense probably benign 0.04
IGL02609:Larp4b APN 13 9170680 missense probably damaging 1.00
R0116:Larp4b UTSW 13 9170688 missense probably damaging 1.00
R0390:Larp4b UTSW 13 9158107 intron probably null
R0585:Larp4b UTSW 13 9147493 missense probably damaging 1.00
R0585:Larp4b UTSW 13 9170701 missense probably benign 0.08
R0751:Larp4b UTSW 13 9166309 splice site probably benign
R1184:Larp4b UTSW 13 9166309 splice site probably benign
R1202:Larp4b UTSW 13 9166326 missense possibly damaging 0.84
R1525:Larp4b UTSW 13 9145450 missense probably damaging 1.00
R1599:Larp4b UTSW 13 9122150 missense probably damaging 1.00
R1637:Larp4b UTSW 13 9151097 missense probably benign 0.12
R1833:Larp4b UTSW 13 9151199 missense possibly damaging 0.89
R1852:Larp4b UTSW 13 9137303 critical splice donor site probably null
R2359:Larp4b UTSW 13 9158163 missense probably damaging 0.97
R2973:Larp4b UTSW 13 9166311 splice site probably benign
R3803:Larp4b UTSW 13 9158554 missense probably benign 0.03
R4810:Larp4b UTSW 13 9158591 missense probably benign
R4828:Larp4b UTSW 13 9170898 missense probably damaging 1.00
R5135:Larp4b UTSW 13 9170737 missense probably damaging 1.00
R5250:Larp4b UTSW 13 9170977 utr 3 prime probably benign
R5259:Larp4b UTSW 13 9158184 missense probably damaging 0.98
R5379:Larp4b UTSW 13 9136909 missense probably benign 0.17
R5436:Larp4b UTSW 13 9168900 missense possibly damaging 0.93
R5616:Larp4b UTSW 13 9158659 missense probably damaging 0.98
R5774:Larp4b UTSW 13 9170643 splice site probably null
R5818:Larp4b UTSW 13 9158560 missense probably benign
R6007:Larp4b UTSW 13 9168757 missense probably benign 0.13
R6248:Larp4b UTSW 13 9158702 missense probably benign 0.01
R6452:Larp4b UTSW 13 9147467 missense probably damaging 0.98
R6501:Larp4b UTSW 13 9168793 missense probably damaging 1.00
R7324:Larp4b UTSW 13 9158580 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGCCTCATTTAACCCCAAAGG -3'
(R):5'- TGGACTATAAAAGCTCCCAAGACTC -3'

Sequencing Primer
(F):5'- CCCCAAAGGTGTGTGTGAATAGC -3'
(R):5'- GCTCCCAAGACTCTAAATCTAGC -3'
Posted On2014-08-01