Incidental Mutation 'R1962:Brms1'
ID217049
Institutional Source Beutler Lab
Gene Symbol Brms1
Ensembl Gene ENSMUSG00000080268
Gene Namebreast cancer metastasis-suppressor 1
Synonyms
MMRRC Submission 039976-MU
Accession Numbers

Ncbi RefSeq: NM_134155.1; MGI: 2388804

Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R1962 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5041404-5049917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5045999 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 34 (R34W)
Ref Sequence ENSEMBL: ENSMUSP00000112266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025818] [ENSMUST00000053705] [ENSMUST00000116567] [ENSMUST00000224178] [ENSMUST00000224288] [ENSMUST00000224363] [ENSMUST00000225427] [ENSMUST00000225799]
Predicted Effect probably benign
Transcript: ENSMUST00000025818
SMART Domains Protein: ENSMUSP00000025818
Gene: ENSMUSG00000024883

DomainStartEndE-ValueType
SH2 66 153 2.16e-5 SMART
low complexity region 241 264 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
low complexity region 307 341 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 432 454 N/A INTRINSIC
VPS9 478 596 2.29e-64 SMART
RA 613 694 1.14e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053705
SMART Domains Protein: ENSMUSP00000062016
Gene: ENSMUSG00000047379

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 39 49 N/A INTRINSIC
Pfam:Glyco_transf_49 94 409 3.8e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116567
AA Change: R34W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112266
Gene: ENSMUSG00000080268
AA Change: R34W

DomainStartEndE-ValueType
low complexity region 29 59 N/A INTRINSIC
Pfam:Sds3 60 209 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224254
Predicted Effect probably benign
Transcript: ENSMUST00000224288
Predicted Effect probably benign
Transcript: ENSMUST00000224363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225203
Predicted Effect probably benign
Transcript: ENSMUST00000225427
Predicted Effect probably benign
Transcript: ENSMUST00000225799
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene reduces the metastatic potential, but not the tumorogenicity, of human breast cancer and melanoma cell lines. The protein encoded by this gene localizes primarily to the nucleus and is a component of the mSin3a family of histone deacetylase complexes (HDAC). The protein contains two coiled-coil motifs and several imperfect leucine zipper motifs. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,341,245 I354M probably damaging Het
Abca8a T C 11: 110,026,905 probably null Het
Abca8b T C 11: 109,979,898 R143G probably benign Het
Actn4 T C 7: 28,894,622 D840G probably damaging Het
Agpat5 T C 8: 18,878,010 L197P probably damaging Het
Akr1d1 T C 6: 37,536,048 V93A probably benign Het
Arap2 T C 5: 62,676,664 K820R possibly damaging Het
Armc9 T A 1: 86,207,974 C551S probably damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Cbx2 A G 11: 119,028,569 Q320R possibly damaging Het
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Ccdc30 C T 4: 119,339,791 R426Q probably benign Het
Cdc42bpg T A 19: 6,306,855 V47E probably damaging Het
Cep170b C T 12: 112,738,061 S751L probably damaging Het
Cfap46 A T 7: 139,667,041 L328Q probably damaging Het
Crtc3 A G 7: 80,589,931 F558L probably damaging Het
Cyp2d34 A G 15: 82,618,608 V139A probably benign Het
Dchs1 A G 7: 105,764,201 Y1136H probably damaging Het
Dhrs4 T C 14: 55,487,603 V185A probably damaging Het
Dnah7b A G 1: 46,242,103 K2775E possibly damaging Het
Dst C A 1: 34,191,016 S2238R possibly damaging Het
Duox2 T C 2: 122,297,372 probably null Het
Dusp16 G T 6: 134,718,136 Y577* probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eml5 A G 12: 98,876,311 F176S probably damaging Het
Esco2 C A 14: 65,831,533 R109S probably damaging Het
Galnt7 C T 8: 57,532,714 E541K probably benign Het
Gbf1 C T 19: 46,267,219 T707I probably damaging Het
Gdf5 A G 2: 155,941,752 C427R probably damaging Het
Glyctk T C 9: 106,157,865 M1V probably null Het
Gm5478 T C 15: 101,644,395 E367G probably damaging Het
Gm9268 T C 7: 43,047,400 V620A probably benign Het
Golga7b G A 19: 42,263,329 V5I probably benign Het
Gpt2 T C 8: 85,493,135 L70P probably damaging Het
Gsdmc3 C A 15: 63,858,466 Q416H probably damaging Het
Hoxb5 A G 11: 96,304,092 E160G probably benign Het
Ift81 A T 5: 122,560,709 Y532N probably benign Het
Igf1 G A 10: 87,864,864 C66Y probably damaging Het
Igf1r T C 7: 68,207,275 V995A probably damaging Het
Ip6k1 T C 9: 108,041,088 probably null Het
Jaml T C 9: 45,104,197 I333T possibly damaging Het
Kdm4c T C 4: 74,307,016 probably benign Het
Kdm6b T C 11: 69,401,365 probably benign Het
Krt6a C T 15: 101,691,465 R404H probably damaging Het
Larp4b C A 13: 9,136,842 H69N probably benign Het
Lcat A T 8: 105,941,723 W222R probably damaging Het
Lrrc40 T A 3: 158,040,449 C54S probably benign Het
Mcpt9 T A 14: 56,027,567 H159L probably benign Het
Megf8 T C 7: 25,363,551 V2444A probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Micalcl A T 7: 112,412,844 I634L probably benign Het
Mov10 C T 3: 104,796,977 R835Q probably damaging Het
Mybpc1 A T 10: 88,548,826 L546Q probably damaging Het
Myo6 T C 9: 80,260,835 V427A probably damaging Het
Myom2 T A 8: 15,132,599 probably null Het
Mzt2 G A 16: 15,848,679 R125C probably damaging Het
Neb T A 2: 52,272,937 R2031* probably null Het
Nphp3 T C 9: 104,021,338 S447P probably benign Het
Nrp2 T A 1: 62,718,931 D25E probably benign Het
Nts A G 10: 102,485,057 L57S probably damaging Het
Nudt9 G A 5: 104,065,105 R348H probably benign Het
Olfr1299 T C 2: 111,664,889 I221T probably damaging Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Olfr211 C T 6: 116,493,764 P52S probably benign Het
Olfr401 C A 11: 74,121,824 D178E probably benign Het
Olfr976 T C 9: 39,956,683 Y84C probably benign Het
Pafah1b1 T C 11: 74,699,351 probably benign Het
Piezo2 C A 18: 63,078,840 M1291I probably damaging Het
Pik3ca T C 3: 32,443,867 F486S probably benign Het
Podnl1 C T 8: 84,127,297 H99Y probably benign Het
Prdm6 A T 18: 53,568,161 Y341F probably damaging Het
Prr5l C T 2: 101,758,509 probably null Het
Psmd4 G T 3: 95,036,701 T24N possibly damaging Het
Rbbp8nl G A 2: 180,280,874 T242M probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Scfd1 T C 12: 51,422,986 V438A probably benign Het
Scn9a A G 2: 66,484,311 C1677R probably damaging Het
Sgsm2 T A 11: 74,892,028 H34L probably damaging Het
Shank1 T A 7: 44,344,323 probably null Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Sncaip C T 18: 52,871,362 H354Y probably damaging Het
St8sia2 T A 7: 73,943,309 D333V probably damaging Het
Stxbp2 C A 8: 3,642,672 R575S probably benign Het
Syt9 T A 7: 107,425,107 V69D probably damaging Het
Tanc2 A G 11: 105,798,732 N240S probably benign Het
Tcl1b1 T C 12: 105,164,468 L70S probably benign Het
Tmem44 C T 16: 30,543,401 probably null Het
Tor1b A G 2: 30,956,919 R293G probably benign Het
Trim29 T C 9: 43,311,318 V148A probably benign Het
Trmt10b C A 4: 45,314,378 Y271* probably null Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Ubqln5 T C 7: 104,128,927 D230G probably damaging Het
Ugt2b37 A G 5: 87,254,334 F146S probably damaging Het
Vmn1r160 T A 7: 22,871,402 V60E probably damaging Het
Vmn2r109 T A 17: 20,553,923 D390V probably damaging Het
Vmn2r27 C T 6: 124,223,834 R388Q possibly damaging Het
Vmn2r72 A T 7: 85,749,161 V537D probably benign Het
Vmn2r84 A G 10: 130,390,722 S416P probably damaging Het
Vmn2r98 C A 17: 19,065,333 Y138* probably null Het
Xrra1 A C 7: 99,911,020 E401A probably damaging Het
Zfp280d T A 9: 72,335,080 C688* probably null Het
Zfp3 T A 11: 70,772,128 Y304* probably null Het
Zfp407 A T 18: 84,559,336 D1217E probably benign Het
Zfp658 T C 7: 43,573,821 Y507H possibly damaging Het
Zfyve16 T C 13: 92,522,744 T220A possibly damaging Het
Zmym4 C G 4: 126,902,670 K820N possibly damaging Het
Other mutations in Brms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Brms1 APN 19 5049042 unclassified probably benign
IGL01391:Brms1 APN 19 5046695 missense possibly damaging 0.79
IGL02583:Brms1 APN 19 5046178 missense probably damaging 0.99
PIT4576001:Brms1 UTSW 19 5046201 missense probably damaging 1.00
R0054:Brms1 UTSW 19 5046699 nonsense probably null
R0054:Brms1 UTSW 19 5046699 nonsense probably null
R0670:Brms1 UTSW 19 5045971 missense probably damaging 1.00
R1757:Brms1 UTSW 19 5046407 missense probably damaging 1.00
R6963:Brms1 UTSW 19 5046653 missense probably damaging 1.00
R7096:Brms1 UTSW 19 5046680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGCACGTTTTCAGTGTG -3'
(R):5'- TCACTGACACACTCACTGCG -3'

Sequencing Primer
(F):5'- AGCACGTTTTCAGTGTGGTGAC -3'
(R):5'- GGCGCCGCTCATAGTCTTC -3'
Posted On2014-08-01