Incidental Mutation 'R1964:Tln2'
ID217115
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission 039977-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R1964 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67342135 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 890 (D890G)
Ref Sequence ENSEMBL: ENSMUSP00000148901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784]
Predicted Effect probably benign
Transcript: ENSMUST00000039662
AA Change: D888G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: D888G

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040025
AA Change: D888G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: D888G

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215784
AA Change: D890G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,492 H158Y probably damaging Het
1810009J06Rik T A 6: 40,968,207 C207S probably damaging Het
Aadac T A 3: 60,037,338 probably null Het
Abca6 T A 11: 110,184,676 I1330F probably damaging Het
Adar A T 3: 89,745,895 S263C probably benign Het
Adra2b T C 2: 127,363,814 Y84H probably damaging Het
Arnt2 A T 7: 84,343,789 V181E possibly damaging Het
Atg7 T C 6: 114,706,230 L418P probably damaging Het
Atp2c1 A G 9: 105,446,123 L181P probably damaging Het
Awat2 G A X: 100,404,559 P148S probably damaging Het
Birc6 A G 17: 74,634,885 M2737V possibly damaging Het
Ccdc81 A G 7: 89,886,153 C292R probably benign Het
Cd14 T A 18: 36,726,339 E21V probably damaging Het
Cdc14b A C 13: 64,215,537 C303W probably damaging Het
Cdh23 T C 10: 60,385,222 I1248V probably benign Het
Ceacam1 T C 7: 25,474,708 D174G probably benign Het
Chd7 A G 4: 8,865,978 M717V probably damaging Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Clec4d A G 6: 123,262,360 K9R probably benign Het
Cntnap1 C A 11: 101,178,024 S131* probably null Het
Crybg1 T C 10: 43,958,330 K1581R probably damaging Het
Csf2 T G 11: 54,248,458 T100P probably benign Het
Csrp2 T A 10: 110,932,033 D26E probably benign Het
Cul1 T C 6: 47,502,571 V257A probably damaging Het
Cul4a G A 8: 13,136,406 M505I possibly damaging Het
Cul4a T C 8: 13,136,854 M530T probably benign Het
Dcp2 T C 18: 44,395,971 M51T possibly damaging Het
Ddx60 T A 8: 61,948,869 C260S probably benign Het
Dennd2c G A 3: 103,166,491 R851H probably damaging Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Edem1 T C 6: 108,844,947 W322R probably benign Het
Egflam T C 15: 7,247,105 T527A probably damaging Het
Ephb1 T A 9: 101,971,123 M659L possibly damaging Het
Fbxl2 A G 9: 113,989,169 I203T probably benign Het
Gabbr1 G A 17: 37,048,459 G109R probably damaging Het
Gabra2 T C 5: 71,014,450 I148V possibly damaging Het
Golga1 A G 2: 39,047,087 V161A probably benign Het
Gps2 T G 11: 69,916,420 S301A probably benign Het
H2-D1 T C 17: 35,263,619 L105P probably benign Het
Igdcc4 T C 9: 65,122,769 V367A probably benign Het
Igkv4-69 T G 6: 69,283,798 Y115S probably benign Het
Itga5 A G 15: 103,354,314 L309P probably damaging Het
Itih1 A G 14: 30,929,623 Y871H probably damaging Het
Itpr2 T A 6: 146,111,693 N2662I probably damaging Het
Kctd19 T A 8: 105,388,470 E486D probably damaging Het
Kif5b C T 18: 6,209,059 R901Q possibly damaging Het
Kmt2a G A 9: 44,820,644 S2792F probably benign Het
Magi3 A G 3: 104,020,402 V1023A probably damaging Het
Mapk9 C A 11: 49,854,333 R25S probably null Het
Mb21d1 T G 9: 78,437,455 Y228S probably damaging Het
Memo1 T C 17: 74,245,008 T98A possibly damaging Het
Mill2 A G 7: 18,856,604 K203R probably damaging Het
Mios T A 6: 8,215,798 H331Q probably damaging Het
Muc6 G T 7: 141,640,062 S1566* probably null Het
Muc6 A G 7: 141,640,063 probably benign Het
Napsa T C 7: 44,581,685 F113L probably benign Het
Olfr1154 A G 2: 87,903,667 V3A probably benign Het
Olfr198 T A 16: 59,201,908 I173F possibly damaging Het
Oscp1 T G 4: 126,083,622 V226G possibly damaging Het
Osgin2 G T 4: 15,998,358 S421R probably damaging Het
Pclaf A G 9: 65,893,395 N50D probably damaging Het
Pdgfc A T 3: 81,174,985 I162F probably benign Het
Plag1 T C 4: 3,903,956 T412A probably benign Het
Pogz A T 3: 94,878,193 T820S probably benign Het
Ptpn9 T A 9: 57,059,912 V473D probably damaging Het
Qdpr A T 5: 45,439,318 M66K possibly damaging Het
Qrich1 A G 9: 108,534,422 N382S possibly damaging Het
Rbbp8 T C 18: 11,742,679 V883A possibly damaging Het
Rgl1 T A 1: 152,549,104 I375F probably damaging Het
Rif1 C T 2: 52,098,409 T720I probably benign Het
Rilp A T 11: 75,510,502 Q95L probably benign Het
Rnf169 T A 7: 99,925,525 N621I probably damaging Het
Rps27a T C 11: 29,547,229 K27R probably null Het
Sar1a T C 10: 61,685,168 V54A probably benign Het
Sash1 T A 10: 8,729,713 H971L probably benign Het
Sdk2 G A 11: 113,781,017 Q2102* probably null Het
Serpina1e T A 12: 103,951,207 I68F probably damaging Het
Serpinb9e A C 13: 33,253,491 Q119P probably benign Het
Sh3tc2 A T 18: 61,991,155 K965* probably null Het
Slc16a1 A T 3: 104,649,466 S56C probably damaging Het
Slc26a11 T A 11: 119,380,194 L563Q possibly damaging Het
Smarca2 G T 19: 26,672,724 E24* probably null Het
Smgc G A 15: 91,860,270 G239D probably damaging Het
Sos2 A T 12: 69,616,862 M616K possibly damaging Het
Tet1 T A 10: 62,812,947 D1902V possibly damaging Het
Thap2 C T 10: 115,384,247 C10Y probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Ubqln5 A T 7: 104,128,888 V243E possibly damaging Het
Utrn A T 10: 12,684,437 D1369E probably damaging Het
Vcan A G 13: 89,692,742 V1561A probably benign Het
Vmn1r70 T C 7: 10,633,810 F56S possibly damaging Het
Vmn2r25 A G 6: 123,823,295 L696S possibly damaging Het
Washc2 A G 6: 116,208,987 T53A probably damaging Het
Wnk1 T A 6: 119,934,382 T2417S possibly damaging Het
Zbtb49 A T 5: 38,203,761 C12* probably null Het
Zfp472 C A 17: 32,977,874 P308T possibly damaging Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTGCTGACTTTGATCTGGC -3'
(R):5'- TATCAACACAGCCTGGTAGGAC -3'

Sequencing Primer
(F):5'- CTTTGATCTGGCACTCTTTATATAGG -3'
(R):5'- GTAGGACACAGCTGTTACCCTAG -3'
Posted On2014-08-01