Incidental Mutation 'R1950:Ctla2b'
ID217232
Institutional Source Beutler Lab
Gene Symbol Ctla2b
Ensembl Gene ENSMUSG00000074874
Gene Namecytotoxic T lymphocyte-associated protein 2 beta
SynonymsCtla-2b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1950 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location60895350-60897447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60896049 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 102 (N102S)
Ref Sequence ENSEMBL: ENSMUSP00000131083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021884] [ENSMUST00000171347] [ENSMUST00000225167] [ENSMUST00000225439] [ENSMUST00000225690] [ENSMUST00000225859]
Predicted Effect probably benign
Transcript: ENSMUST00000021884
AA Change: N102S

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021884
Gene: ENSMUSG00000074874
AA Change: N102S

DomainStartEndE-ValueType
Inhibitor_I29 16 75 1.85e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171347
AA Change: N102S

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131083
Gene: ENSMUSG00000074874
AA Change: N102S

DomainStartEndE-ValueType
Inhibitor_I29 16 75 1.85e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225167
AA Change: N126S

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000225382
Predicted Effect probably benign
Transcript: ENSMUST00000225439
Predicted Effect probably benign
Transcript: ENSMUST00000225690
Predicted Effect unknown
Transcript: ENSMUST00000225732
AA Change: N48S
Predicted Effect probably benign
Transcript: ENSMUST00000225802
Predicted Effect probably benign
Transcript: ENSMUST00000225859
AA Change: N126S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 3,960,677 N478S probably damaging Het
Als2 T A 1: 59,185,601 probably null Het
Ankfy1 A G 11: 72,760,329 Y1035C probably damaging Het
Ankrd11 T C 8: 122,889,869 T2394A probably damaging Het
Axin1 G C 17: 26,193,964 G780R possibly damaging Het
Carm1 A T 9: 21,574,516 T127S probably benign Het
Ccdc73 T C 2: 104,926,935 I81T probably benign Het
Cdh12 T C 15: 21,237,879 Y67H probably damaging Het
Cfap65 C A 1: 74,907,660 G1297V probably damaging Het
Cfap74 T C 4: 155,427,430 probably null Het
Chit1 A G 1: 134,151,230 Y426C probably damaging Het
Clpp A G 17: 56,996,039 probably benign Het
Clrn3 T G 7: 135,514,084 Y179S possibly damaging Het
Cntn5 A C 9: 9,781,769 M635R probably damaging Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Cwf19l2 A T 9: 3,418,674 I154F probably benign Het
Cyhr1 A G 15: 76,659,217 probably null Het
Dffa C A 4: 149,104,382 S44R probably benign Het
Ehbp1 T A 11: 22,059,228 K930M probably damaging Het
Erc2 T A 14: 27,912,900 S473T probably damaging Het
Fam71f1 C T 6: 29,335,816 probably null Het
Fbxw24 A T 9: 109,605,413 L373H probably benign Het
Fer1l4 T C 2: 156,048,274 I244V probably damaging Het
Fgfr2 G A 7: 130,198,481 T245M probably damaging Het
Gbp9 T A 5: 105,081,246 M512L probably benign Het
Glg1 T A 8: 111,165,639 K251I possibly damaging Het
Gm10553 A G 1: 85,100,420 D86G possibly damaging Het
Gm10767 A G 13: 66,907,205 probably benign Het
Gm5622 T C 14: 51,655,772 V52A probably benign Het
Gucy1b1 A G 3: 82,045,409 V239A probably benign Het
Gzma A G 13: 113,093,929 L246P probably damaging Het
Hibadh C A 6: 52,556,463 A223S probably benign Het
Hydin C A 8: 110,609,987 T5132N possibly damaging Het
Insrr A G 3: 87,814,513 N1198S probably damaging Het
Ivl T C 3: 92,572,113 E215G possibly damaging Het
Jmjd1c A G 10: 67,239,922 D2037G possibly damaging Het
Kcna3 G A 3: 107,037,672 C417Y probably damaging Het
Klra2 T C 6: 131,230,115 N177S probably benign Het
Llgl2 T C 11: 115,851,066 S645P probably damaging Het
Lrrc15 T C 16: 30,273,831 E230G probably benign Het
Magel2 C A 7: 62,378,415 Q356K possibly damaging Het
Mcm6 A G 1: 128,345,989 V368A probably benign Het
Myh8 G A 11: 67,279,004 V50M possibly damaging Het
Myrf A T 19: 10,218,190 F419I possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1330 G A 4: 118,893,340 V86M probably benign Het
Olfr556 A G 7: 102,670,477 M186V probably benign Het
Otud4 G A 8: 79,646,332 R93H probably damaging Het
Pank4 T A 4: 154,972,520 M390K probably benign Het
Pecam1 A G 11: 106,685,203 V401A probably damaging Het
Prdm6 C A 18: 53,536,724 T138K possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prpf8 A G 11: 75,496,511 E1206G possibly damaging Het
Prr30 A T 14: 101,197,941 I395N probably benign Het
Rab27a G A 9: 73,075,469 G19R probably damaging Het
Rrp12 A G 19: 41,892,590 V134A probably damaging Het
Scly A G 1: 91,305,394 T76A probably benign Het
Scube3 T C 17: 28,164,300 S439P possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sipa1l1 T C 12: 82,341,459 F153S probably damaging Het
Slc25a30 T G 14: 75,769,567 K163T possibly damaging Het
Slc26a8 T A 17: 28,644,640 D715V probably benign Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Smr2 C CT 5: 88,108,826 probably null Het
Sp6 T G 11: 97,022,114 S218A probably benign Het
Spata21 T C 4: 141,111,405 V589A probably damaging Het
Sycp2 T C 2: 178,402,800 I71V probably benign Het
Syne2 G T 12: 75,952,870 G2347C probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Thbs4 A T 13: 92,769,571 N387K probably damaging Het
Tmem184a T C 5: 139,807,626 D216G probably damaging Het
Tprg T A 16: 25,317,348 S30T possibly damaging Het
Trip12 A T 1: 84,760,801 W778R probably damaging Het
Ttpa T C 4: 20,008,633 L65P probably damaging Het
Ush2a A T 1: 188,755,185 N3050I probably damaging Het
Xpot T C 10: 121,619,148 I30V probably benign Het
Zfp944 A G 17: 22,339,700 S189P probably benign Het
Other mutations in Ctla2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Ctla2b APN 13 60896689 makesense probably null
IGL03088:Ctla2b APN 13 60896060 missense probably damaging 1.00
R0179:Ctla2b UTSW 13 60896293 missense possibly damaging 0.82
R2001:Ctla2b UTSW 13 60896067 missense probably damaging 0.99
R3859:Ctla2b UTSW 13 60896043 missense possibly damaging 0.79
R5226:Ctla2b UTSW 13 60896332 nonsense probably null
R5393:Ctla2b UTSW 13 60896132 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTACAGTGGCTTTGTCAC -3'
(R):5'- TGACTTGGTGAGTGAGACACTG -3'

Sequencing Primer
(F):5'- GCAGTACAGTGGCTTTGTCACAATAC -3'
(R):5'- GTGAGTGAGACACTGATTGTTAATTC -3'
Posted On2014-08-01