Incidental Mutation 'R1951:Arhgap28'
ID217332
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
MMRRC Submission 039965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R1951 (G1)
Quality Score179
Status Validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67901341 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 44 (A44V)
Ref Sequence ENSEMBL: ENSMUSP00000130960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect probably benign
Transcript: ENSMUST00000024840
AA Change: A94V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: A94V

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163865
AA Change: A44V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: A44V

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164647
AA Change: A44V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: A44V

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 C T 7: 120,361,432 R706C probably damaging Het
Adcy3 T C 12: 4,208,624 F847S probably benign Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Asap3 C T 4: 136,227,456 R60* probably null Het
Baz1b T A 5: 135,216,739 N347K probably benign Het
Best2 T A 8: 85,011,229 N179I possibly damaging Het
Bfar C T 16: 13,702,106 S276L probably damaging Het
Bloc1s3 A G 7: 19,507,558 V15A possibly damaging Het
Borcs5 A G 6: 134,710,267 H196R unknown Het
Calhm3 A G 19: 47,151,817 L279P probably benign Het
Cand1 A T 10: 119,208,020 probably benign Het
Car15 T C 16: 17,837,405 D57G possibly damaging Het
Casp12 G A 9: 5,348,959 probably null Het
Cd93 T C 2: 148,441,858 T523A probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckap5 A G 2: 91,556,492 probably benign Het
Col6a5 G A 9: 105,936,957 R619W unknown Het
Colec12 G A 18: 9,859,975 probably null Het
Crmp1 G A 5: 37,273,355 V222I possibly damaging Het
Crnkl1 G A 2: 145,928,200 A241V probably damaging Het
Ctbp2 A G 7: 133,015,027 S60P probably benign Het
Cyp2c68 T C 19: 39,712,528 Y282C probably benign Het
Dhx36 T C 3: 62,484,273 I551V probably damaging Het
Dlg5 T A 14: 24,156,469 probably benign Het
Dlgap1 A T 17: 70,761,311 I300F probably damaging Het
Dmd T A X: 83,830,517 I1342N probably damaging Het
Dnah6 T A 6: 73,084,721 R2794* probably null Het
Fcgr1 G A 3: 96,287,070 T167I probably damaging Het
Fgl1 G T 8: 41,197,350 F187L probably benign Het
Fras1 T A 5: 96,712,383 V2096E probably benign Het
Gm10647 A G 9: 66,798,480 probably benign Het
Gm14226 G A 2: 155,024,335 D71N possibly damaging Het
Grip2 A T 6: 91,783,848 I284N probably damaging Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Irx5 A G 8: 92,359,810 N174D probably damaging Het
Itgal A G 7: 127,330,145 D1078G probably damaging Het
Khdc3 T C 9: 73,103,237 V123A possibly damaging Het
Klhl13 A G X: 23,261,581 probably benign Het
Klhl42 T C 6: 147,091,823 S98P probably damaging Het
Lrp5 T C 19: 3,620,298 N602S possibly damaging Het
Lrrd1 A T 5: 3,851,488 I598F probably damaging Het
Ltbp1 A G 17: 75,151,377 T318A probably benign Het
Mfsd6 A G 1: 52,709,358 F116S probably damaging Het
Ncam1 T C 9: 49,545,192 I486V probably benign Het
Nptx1 A G 11: 119,543,180 probably null Het
Nrg1 T C 8: 31,918,193 Y4C probably damaging Het
Nsf G A 11: 103,882,876 R271* probably null Het
Olfr1049 G C 2: 86,255,096 T199S probably benign Het
Olfr1053 T A 2: 86,315,160 N42I probably damaging Het
Olfr1058 A T 2: 86,385,511 H302Q probably benign Het
Olfr1167 A G 2: 88,149,297 S241P possibly damaging Het
Olfr938 T A 9: 39,078,284 I154F probably benign Het
Pax2 A G 19: 44,788,832 T155A probably benign Het
Pdia4 A G 6: 47,803,879 Y212H probably damaging Het
Pgr A G 9: 8,946,953 probably benign Het
Pitpnm3 G T 11: 72,074,624 H112N possibly damaging Het
Ppargc1b G T 18: 61,298,777 T1000K possibly damaging Het
Psd3 C A 8: 67,963,487 C586F probably benign Het
Ptprm A T 17: 66,940,580 S587T probably benign Het
Rabep2 A T 7: 126,438,564 R169S possibly damaging Het
Rad21l T C 2: 151,655,259 R309G probably benign Het
Rbm12 T C 2: 156,097,213 R380G probably damaging Het
Selp A G 1: 164,126,512 N127S probably benign Het
Slc12a2 A G 18: 57,879,395 T197A possibly damaging Het
Slc22a18 C T 7: 143,476,247 T17I probably damaging Het
Sptbn4 T C 7: 27,366,443 E2026G possibly damaging Het
Srf A T 17: 46,551,707 M285K possibly damaging Het
Tanc1 T C 2: 59,791,812 V425A possibly damaging Het
Tle4 A T 19: 14,516,357 probably null Het
Tmem132e A G 11: 82,445,082 R905G possibly damaging Het
Tmem200c A T 17: 68,840,988 I189F probably damaging Het
Trappc13 T C 13: 104,174,642 Q87R probably benign Het
Trpm7 A T 2: 126,831,299 D511E probably damaging Het
Ttc30b A G 2: 75,937,242 L389P probably damaging Het
Ttn A T 2: 76,802,290 I14140N possibly damaging Het
Virma A G 4: 11,513,907 D587G probably benign Het
Vmn1r72 A G 7: 11,669,804 L239P probably damaging Het
Vmn2r68 A G 7: 85,233,894 F217L probably damaging Het
Vps13c T C 9: 67,973,759 probably null Het
Vrtn T C 12: 84,649,199 V241A probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zranb3 A T 1: 127,999,399 V343D probably damaging Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1747:Arhgap28 UTSW 17 67901309 missense probably benign 0.02
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3700:Arhgap28 UTSW 17 67901366 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4347:Arhgap28 UTSW 17 67873142 missense probably benign
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R5774:Arhgap28 UTSW 17 67881492 missense possibly damaging 0.94
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6661:Arhgap28 UTSW 17 67845751 missense probably damaging 1.00
R6928:Arhgap28 UTSW 17 67901299 small deletion probably benign
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CAGGCCCAGTCTGTTTGAAG -3'
(R):5'- TTTACACAGGCACCCAGTTTC -3'

Sequencing Primer
(F):5'- GCCCAGTCTGTTTGAAGAAAAAG -3'
(R):5'- GGCACCCAGTTTCATTCAAATG -3'
Posted On2014-08-01