Incidental Mutation 'R0133:Kif17'
ID21739
Institutional Source Beutler Lab
Gene Symbol Kif17
Ensembl Gene ENSMUSG00000028758
Gene Namekinesin family member 17
SynonymsN-4 kinesin, 5930435E01Rik, Kif17b
MMRRC Submission 038418-MU
Accession Numbers

Genbank: NM_010623; MGI: 1098229

Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0133 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location138250435-138301967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138278245 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 182 (S182P)
Ref Sequence ENSEMBL: ENSMUSP00000101444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030539] [ENSMUST00000105818] [ENSMUST00000105821]
Predicted Effect probably benign
Transcript: ENSMUST00000030539
AA Change: S374P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030539
Gene: ENSMUSG00000028758
AA Change: S374P

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
coiled coil region 400 470 N/A INTRINSIC
low complexity region 723 736 N/A INTRINSIC
coiled coil region 806 852 N/A INTRINSIC
low complexity region 983 1000 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105818
AA Change: S182P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101444
Gene: ENSMUSG00000028758
AA Change: S182P

DomainStartEndE-ValueType
KISc 1 151 1.46e-13 SMART
coiled coil region 208 278 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
coiled coil region 615 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105820
Predicted Effect probably benign
Transcript: ENSMUST00000105821
AA Change: S374P

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101447
Gene: ENSMUSG00000028758
AA Change: S374P

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
low complexity region 486 499 N/A INTRINSIC
coiled coil region 569 615 N/A INTRINSIC
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired anterograde neuron transport, reduced NMDA-mediated synaptic currents, impaired synaptic plasticity, impaired long term object recognition memory, impaired spatial learning, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Kif17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Kif17 APN 4 138262708 missense possibly damaging 0.66
IGL00973:Kif17 APN 4 138275057 missense probably benign 0.06
IGL01527:Kif17 APN 4 138269086 missense probably benign 0.21
IGL01559:Kif17 APN 4 138293769 missense probably damaging 0.99
IGL01736:Kif17 APN 4 138286565 missense possibly damaging 0.96
IGL02671:Kif17 APN 4 138288061 missense possibly damaging 0.85
IGL02976:Kif17 APN 4 138269063 missense probably damaging 1.00
IGL03051:Kif17 APN 4 138289254 missense probably damaging 0.99
IGL03285:Kif17 APN 4 138268990 missense probably damaging 0.97
easy_company UTSW 4 138288332 nonsense probably null
fiddle UTSW 4 138286480 missense probably benign 0.18
fidget UTSW 4 138269891 missense probably damaging 1.00
A5278:Kif17 UTSW 4 138287950 missense probably benign 0.33
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0012:Kif17 UTSW 4 138293748 missense probably damaging 0.99
R0627:Kif17 UTSW 4 138288487 critical splice donor site probably null
R0670:Kif17 UTSW 4 138262499 unclassified probably benign
R0894:Kif17 UTSW 4 138298231 missense possibly damaging 0.93
R1367:Kif17 UTSW 4 138277994 nonsense probably null
R1648:Kif17 UTSW 4 138269895 missense probably damaging 1.00
R1674:Kif17 UTSW 4 138301258 missense probably benign 0.13
R1700:Kif17 UTSW 4 138262698 nonsense probably null
R1855:Kif17 UTSW 4 138288271 missense probably benign 0.44
R2137:Kif17 UTSW 4 138262667 missense probably damaging 0.98
R2170:Kif17 UTSW 4 138288371 missense probably benign 0.01
R3008:Kif17 UTSW 4 138278165 missense probably damaging 1.00
R3855:Kif17 UTSW 4 138291510 missense probably benign 0.18
R4591:Kif17 UTSW 4 138277799 missense probably benign 0.06
R4789:Kif17 UTSW 4 138281377 missense probably damaging 1.00
R5407:Kif17 UTSW 4 138298221 missense probably damaging 1.00
R5859:Kif17 UTSW 4 138291433 missense possibly damaging 0.71
R5901:Kif17 UTSW 4 138298332 splice site probably null
R5919:Kif17 UTSW 4 138269891 missense probably damaging 1.00
R6119:Kif17 UTSW 4 138288332 nonsense probably null
R6312:Kif17 UTSW 4 138288193 missense probably benign 0.40
R6693:Kif17 UTSW 4 138286480 missense probably benign 0.18
R6774:Kif17 UTSW 4 138274995 missense probably damaging 1.00
R6838:Kif17 UTSW 4 138278399 intron probably null
R6863:Kif17 UTSW 4 138269884 nonsense probably null
R7205:Kif17 UTSW 4 138293766 missense probably benign 0.21
R7307:Kif17 UTSW 4 138262643 missense probably benign 0.00
R7336:Kif17 UTSW 4 138298306 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAGTACGCTGCGCTATGCTAAC -3'
(R):5'- ATGCTAAGAACATGATGTCCCTGCC -3'

Sequencing Primer
(F):5'- TGCGCTATGCTAACAGGGC -3'
(R):5'- ATGATGTCCCTGCCACTGAG -3'
Posted On2013-04-12