Incidental Mutation 'R0133:Il27ra'
ID21754
Institutional Source Beutler Lab
Gene Symbol Il27ra
Ensembl Gene ENSMUSG00000005465
Gene Nameinterleukin 27 receptor, alpha
SynonymsIL-27R, WSX-1, Tccr
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0133 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84030294-84042589 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 84033942 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000055077]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055077
SMART Domains Protein: ENSMUSP00000051396
Gene: ENSMUSG00000047986

DomainStartEndE-ValueType
coiled coil region 19 64 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
coiled coil region 90 116 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
low complexity region 399 416 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mice, CD4+ helper T-cells differentiate into type 1 (Th1) cells, which are critical for cell-mediated immunity, predominantly under the influence of IL12. Also, IL4 influences their differentiation into type 2 (Th2) cells, which are critical for most antibody responses. Mice deficient in these cytokines, their receptors, or associated transcription factors have impaired, but are not absent of, Th1 or Th2 immune responses. This gene encodes a protein which is similar to the mouse T-cell cytokine receptor Tccr at the amino acid level, and is predicted to be a glycosylated transmembrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: T helper 1 response and responses to parasitic and bacterial infection are altered in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Il27ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Il27ra APN 8 84031535 missense probably benign 0.01
IGL03096:Il27ra APN 8 84031532 missense probably damaging 1.00
IGL03334:Il27ra APN 8 84031122 missense probably benign 0.08
angel UTSW 8 84032144 critical splice acceptor site probably null
R0526:Il27ra UTSW 8 84039499 missense probably benign 0.37
R2914:Il27ra UTSW 8 84031613 unclassified probably benign
R3001:Il27ra UTSW 8 84032031 nonsense probably null
R3002:Il27ra UTSW 8 84032031 nonsense probably null
R3003:Il27ra UTSW 8 84032031 nonsense probably null
R3851:Il27ra UTSW 8 84040688 missense probably benign 0.00
R3978:Il27ra UTSW 8 84040684 missense probably benign 0.11
R4589:Il27ra UTSW 8 84036409 missense probably damaging 1.00
R4997:Il27ra UTSW 8 84039527 nonsense probably null
R5133:Il27ra UTSW 8 84034059 missense possibly damaging 0.71
R5955:Il27ra UTSW 8 84040822 missense probably benign 0.05
R6153:Il27ra UTSW 8 84032144 critical splice acceptor site probably null
R6489:Il27ra UTSW 8 84031550 missense probably benign 0.02
X0013:Il27ra UTSW 8 84042159 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCTCGAAACTGAACTGCCTCTCTC -3'
(R):5'- AGTTTGGCGACTTCCAGATGACC -3'

Sequencing Primer
(F):5'- cctctctccctccttctttcc -3'
(R):5'- TTCCAGATGACCCCCCAGG -3'
Posted On2013-04-12