Incidental Mutation 'R1955:Plch1'
ID217643
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Namephospholipase C, eta 1
SynonymsPLCeta1, Plcl3
MMRRC Submission 039969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1955 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location63696234-63899472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63755267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 272 (V272I)
Ref Sequence ENSEMBL: ENSMUSP00000124463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]
Predicted Effect probably damaging
Transcript: ENSMUST00000048134
AA Change: V254I

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: V254I

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059973
AA Change: V272I

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: V272I

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084105
AA Change: V272I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: V272I

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159676
AA Change: V272I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: V272I

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160638
AA Change: V272I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: V272I

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162269
AA Change: V272I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: V272I

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175947
AA Change: V272I

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: V272I

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177143
AA Change: V284I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: V284I

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T A 1: 53,163,241 K128N probably benign Het
4930430F08Rik A G 10: 100,577,304 V91A probably damaging Het
Acadm A C 3: 153,929,551 F309V probably damaging Het
Adam6b C A 12: 113,491,816 A751E probably benign Het
Adcy9 A G 16: 4,418,659 I296T possibly damaging Het
Arhgap45 A G 10: 80,026,492 E471G probably benign Het
Atcay T C 10: 81,214,793 D96G possibly damaging Het
B3galt4 T A 17: 33,950,632 R211* probably null Het
Bpi T C 2: 158,274,715 I344T probably damaging Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cd207 T A 6: 83,671,775 R302W probably benign Het
Cdc5l T C 17: 45,426,516 probably null Het
Chaf1a C T 17: 56,047,540 T270I unknown Het
Col4a1 C T 8: 11,208,228 probably null Het
Col7a1 G T 9: 108,955,664 V187L unknown Het
Cry1 G A 10: 85,144,178 T422I probably benign Het
Csgalnact1 C T 8: 68,372,667 V392I probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Ddx20 G A 3: 105,679,562 T489M possibly damaging Het
Decr1 A T 4: 15,924,256 N221K probably benign Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dgka A G 10: 128,730,189 probably null Het
Dmd A T X: 83,878,557 M1478L probably benign Het
Dvl1 G A 4: 155,858,029 R584Q possibly damaging Het
Dync1li1 A T 9: 114,721,746 S450C probably damaging Het
Ehbp1l1 A G 19: 5,710,669 V1558A possibly damaging Het
Esr1 T A 10: 4,857,125 M347K probably damaging Het
F2 T A 2: 91,633,095 H148L probably benign Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fscn3 T A 6: 28,430,236 M135K possibly damaging Het
Ganab T G 19: 8,911,616 Y560* probably null Het
Garem2 T C 5: 30,108,270 V44A probably benign Het
Gja4 A G 4: 127,312,449 W174R probably damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Gm43517 A G 12: 49,389,889 probably benign Het
Gm5434 A G 12: 36,090,596 probably benign Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Kifc5b T A 17: 26,926,297 probably null Het
Kmt2b A T 7: 30,575,351 M1976K possibly damaging Het
Leng1 A T 7: 3,665,416 V11D probably damaging Het
Lrit3 A G 3: 129,800,481 V149A probably benign Het
Lrpap1 A G 5: 35,102,412 L114P probably damaging Het
Marveld3 T A 8: 109,959,748 D162V probably benign Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Myo7a A T 7: 98,054,921 V1928D probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Nexmif A G X: 104,083,953 S1453P possibly damaging Het
Nudt16l1 A G 16: 4,940,325 M182V probably benign Het
Obp2b A T 2: 25,738,551 I106L probably benign Het
Olfr1129 T A 2: 87,576,005 L307Q probably damaging Het
Olfr1239 T A 2: 89,418,411 M1L probably damaging Het
Olfr186 T A 16: 59,027,411 R165S probably damaging Het
Olfr902 T C 9: 38,449,688 I272T probably benign Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Pde7a G A 3: 19,227,799 A429V probably damaging Het
Pkd1l2 T A 8: 117,043,361 M1119L probably benign Het
Plekha4 G A 7: 45,553,906 G740D probably damaging Het
Pnliprp1 A G 19: 58,734,972 D265G possibly damaging Het
Pola1 A C X: 93,597,261 V384G probably damaging Het
Pon3 T A 6: 5,230,774 D251V probably benign Het
Pot1b A G 17: 55,674,067 C316R possibly damaging Het
Prkaca T A 8: 83,988,317 V116E probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Rasgef1c A G 11: 49,975,715 H382R possibly damaging Het
Rps25 C T 9: 44,410,008 T113I probably benign Het
Serpinb1b G T 13: 33,085,439 A52S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Siah2 C T 3: 58,676,097 R256Q probably damaging Het
Slc24a2 A G 4: 87,073,244 L404P probably damaging Het
Slc28a2 G A 2: 122,447,866 C122Y probably benign Het
Slc4a8 T C 15: 100,807,376 I821T probably damaging Het
Slc5a3 T C 16: 92,077,874 V273A possibly damaging Het
Spag7 T C 11: 70,665,018 Q61R probably benign Het
Syt7 A T 19: 10,418,038 I71F probably damaging Het
Tars2 T C 3: 95,747,454 N413S probably damaging Het
Tex14 T A 11: 87,509,621 L413Q probably damaging Het
Tjp3 T C 10: 81,277,999 E475G probably damaging Het
Tmem131l A G 3: 83,961,544 S175P probably damaging Het
Tmem144 C T 3: 79,826,857 V180M probably benign Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmprss11g T A 5: 86,498,532 I59F probably damaging Het
Tmprss2 T A 16: 97,567,177 probably null Het
Tor1aip2 T A 1: 156,051,842 probably benign Het
Trim61 T C 8: 65,013,392 I406V possibly damaging Het
Trpv5 T C 6: 41,657,937 D486G probably damaging Het
Try5 T C 6: 41,311,769 E64G probably benign Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Ugt2b1 T C 5: 86,917,713 Y489C probably damaging Het
Ugt2b5 T A 5: 87,127,772 M418L probably benign Het
Vmn1r191 A T 13: 22,178,815 S256R possibly damaging Het
Vps13b T G 15: 35,925,408 probably null Het
Vps13d A G 4: 145,156,143 F960S probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Xaf1 A T 11: 72,306,606 D136V possibly damaging Het
Zan A G 5: 137,389,283 S4889P unknown Het
Zfp78 A G 7: 6,378,559 T203A probably benign Het
Zfp821 T C 8: 109,721,242 S72P probably damaging Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63731729 splice site probably null
IGL01542:Plch1 APN 3 63731649 missense probably damaging 0.99
IGL01999:Plch1 APN 3 63753307 missense probably damaging 1.00
IGL02153:Plch1 APN 3 63781351 missense probably damaging 1.00
IGL02203:Plch1 APN 3 63698739 missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63698961 missense probably damaging 0.97
IGL02259:Plch1 APN 3 63722749 critical splice donor site probably null
IGL02268:Plch1 APN 3 63699283 makesense probably null
IGL02411:Plch1 APN 3 63697756 unclassified probably null
IGL02472:Plch1 APN 3 63701849 missense probably damaging 1.00
IGL02477:Plch1 APN 3 63753293 missense probably damaging 1.00
IGL02503:Plch1 APN 3 63697864 missense probably damaging 1.00
IGL02800:Plch1 APN 3 63698478 missense probably benign 0.21
IGL03167:Plch1 APN 3 63722744 splice site probably benign
IGL03182:Plch1 APN 3 63702594 nonsense probably null
IGL03197:Plch1 APN 3 63753170 missense probably damaging 1.00
IGL03251:Plch1 APN 3 63784002 missense possibly damaging 0.93
R0335:Plch1 UTSW 3 63710978 missense probably damaging 1.00
R0347:Plch1 UTSW 3 63753316 missense probably damaging 1.00
R0631:Plch1 UTSW 3 63699219 missense probably benign 0.23
R0687:Plch1 UTSW 3 63716029 missense probably damaging 1.00
R0738:Plch1 UTSW 3 63702553 intron probably benign
R0883:Plch1 UTSW 3 63753256 missense probably damaging 1.00
R1437:Plch1 UTSW 3 63697533 missense probably benign 0.37
R1678:Plch1 UTSW 3 63740694 missense probably damaging 1.00
R1738:Plch1 UTSW 3 63719238 missense probably benign 0.12
R1929:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R2078:Plch1 UTSW 3 63701943 missense probably benign 0.01
R2112:Plch1 UTSW 3 63722806 missense probably damaging 1.00
R2158:Plch1 UTSW 3 63721234 missense probably benign 0.00
R2165:Plch1 UTSW 3 63698482 missense probably benign 0.01
R2259:Plch1 UTSW 3 63697977 missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R3110:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3112:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3407:Plch1 UTSW 3 63699347 unclassified probably benign
R3408:Plch1 UTSW 3 63699347 unclassified probably benign
R3791:Plch1 UTSW 3 63699523 missense probably benign
R3793:Plch1 UTSW 3 63697831 missense probably damaging 0.96
R3928:Plch1 UTSW 3 63767623 missense probably damaging 1.00
R4211:Plch1 UTSW 3 63711219 missense probably damaging 1.00
R4212:Plch1 UTSW 3 63870759 start gained probably benign
R4223:Plch1 UTSW 3 63701900 missense probably damaging 1.00
R4491:Plch1 UTSW 3 63740739 missense probably damaging 1.00
R4589:Plch1 UTSW 3 63781507 missense probably damaging 1.00
R4656:Plch1 UTSW 3 63704177 missense probably damaging 1.00
R4701:Plch1 UTSW 3 63699496 intron probably null
R4716:Plch1 UTSW 3 63781546 missense probably damaging 1.00
R4772:Plch1 UTSW 3 63753325 missense probably damaging 1.00
R4902:Plch1 UTSW 3 63740843 intron probably benign
R5058:Plch1 UTSW 3 63722781 missense probably damaging 1.00
R5092:Plch1 UTSW 3 63698710 missense probably benign 0.02
R5093:Plch1 UTSW 3 63773715 missense probably damaging 0.99
R5210:Plch1 UTSW 3 63699778 critical splice donor site probably null
R5368:Plch1 UTSW 3 63701973 missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5374:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5501:Plch1 UTSW 3 63707741 missense probably damaging 1.00
R5606:Plch1 UTSW 3 63740687 missense probably benign 0.35
R5738:Plch1 UTSW 3 63773655 missense probably damaging 1.00
R5835:Plch1 UTSW 3 63697522 missense probably benign
R6106:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6107:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6108:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6110:Plch1 UTSW 3 63698858 missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6147:Plch1 UTSW 3 63722881 missense probably damaging 1.00
R6195:Plch1 UTSW 3 63740789 missense probably damaging 1.00
R6315:Plch1 UTSW 3 63781390 nonsense probably null
R6316:Plch1 UTSW 3 63781390 nonsense probably null
R6317:Plch1 UTSW 3 63781390 nonsense probably null
R6318:Plch1 UTSW 3 63781390 nonsense probably null
R6324:Plch1 UTSW 3 63781390 nonsense probably null
R6325:Plch1 UTSW 3 63781390 nonsense probably null
R6326:Plch1 UTSW 3 63781390 nonsense probably null
R6479:Plch1 UTSW 3 63744510 missense probably benign 0.06
R6544:Plch1 UTSW 3 63850978 missense probably damaging 1.00
R6767:Plch1 UTSW 3 63755344 missense probably damaging 1.00
R6829:Plch1 UTSW 3 63697518 missense probably damaging 0.99
R6891:Plch1 UTSW 3 63698083 missense probably benign
R6893:Plch1 UTSW 3 63753141 nonsense probably null
R6921:Plch1 UTSW 3 63707734 missense possibly damaging 0.90
X0028:Plch1 UTSW 3 63744509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAATGGTAGCTTAAGGAGTACGGC -3'
(R):5'- TCCAGACAGTGCTTCCTGAAG -3'

Sequencing Primer
(F):5'- TAGCTTAAGGAGTACGGCAAAAATAG -3'
(R):5'- TGAAGCGCCCTGAACTATG -3'
Posted On2014-08-01