Incidental Mutation 'R0133:Myo15'
ID21769
Institutional Source Beutler Lab
Gene Symbol Myo15
Ensembl Gene ENSMUSG00000042678
Gene Namemyosin XV
Synonymssh2; sh-2; Myo15a
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0133 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60469339-60528369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60477850 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 479 (F479L)
Ref Sequence ENSEMBL: ENSMUSP00000091686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071880
AA Change: F479L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: F479L

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081823
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094135
AA Change: F479L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: F479L

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126522
SMART Domains Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 34 716 N/A SMART
IQ 717 739 1.63e-1 SMART
IQ 740 762 1.77e-2 SMART
IQ 763 785 2.97e2 SMART
low complexity region 806 820 N/A INTRINSIC
MyTH4 863 1009 1.8e-42 SMART
low complexity region 1210 1219 N/A INTRINSIC
low complexity region 1265 1275 N/A INTRINSIC
Blast:MYSc 1479 1662 5e-15 BLAST
SH3 1665 1747 1.55e-4 SMART
low complexity region 1763 1776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Myo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 splice site probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 splice site probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 splice site probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
parker UTSW 11 60520914 critical splice donor site probably null
typhoon UTSW 11 60487425 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60495454 missense probably damaging 1.00
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 unclassified probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 unclassified probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6467:Myo15 UTSW 11 60526661 critical splice donor site probably null
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6821:Myo15 UTSW 11 60524475 missense probably damaging 1.00
R6882:Myo15 UTSW 11 60524006 missense probably damaging 1.00
R6908:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R6932:Myo15 UTSW 11 60499494 missense probably damaging 1.00
R6958:Myo15 UTSW 11 60503625 missense probably benign 0.07
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCCCTATGTCTATCCAGAAGAGCC -3'
(R):5'- TTTGAGGAACCGTGCCAGTGAG -3'

Sequencing Primer
(F):5'- GAAGAGCCAGCTTTTATGTACCC -3'
(R):5'- TTGGCGGGCACCAAAGG -3'
Posted On2013-04-12