Incidental Mutation 'R1956:Kmt2d'
ID217845
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Namelysine (K)-specific methyltransferase 2D
SynonymsMll2, C430014K11Rik, Mll4
MMRRC Submission 039970-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1956 (G1)
Quality Score211
Status Not validated
Chromosome15
Chromosomal Location98831669-98871204 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 98859590 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486] [ENSMUST00000184363]
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: F1342L
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: F1342L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: F1342L
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: F1342L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184363
SMART Domains Protein: ENSMUSP00000139020
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,970,105 probably null Het
2610044O15Rik8 A T 8: 129,221,828 D41E possibly damaging Het
Aard A T 15: 52,044,920 D157V probably damaging Het
Abcg5 A G 17: 84,670,375 V151A probably damaging Het
Acss3 A G 10: 106,936,168 V682A probably benign Het
Adamts9 A T 6: 92,859,849 C641S probably damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Ankrd27 T A 7: 35,603,839 Y215N probably damaging Het
Arhgef7 T A 8: 11,805,266 L182Q probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arrdc4 T C 7: 68,741,799 K240R probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
Atp13a2 A G 4: 141,004,261 K907R possibly damaging Het
Cadps2 A T 6: 23,287,686 M1160K probably damaging Het
Ccdc105 A G 10: 78,750,539 probably null Het
Cdk12 A G 11: 98,219,216 T688A probably benign Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Crabp2 T C 3: 87,948,886 F16L probably damaging Het
Creb3 A G 4: 43,563,279 probably null Het
Crk T C 11: 75,692,670 Y239H possibly damaging Het
Cyp3a13 A G 5: 137,909,942 I215T probably benign Het
D130043K22Rik A G 13: 24,885,595 Y879C probably damaging Het
Depdc5 T C 5: 32,903,831 V334A probably damaging Het
Dgkh T C 14: 78,618,541 N231S probably damaging Het
Disp2 T A 2: 118,792,223 H1145Q probably benign Het
Epb41l4b T C 4: 57,038,553 T563A possibly damaging Het
Ephb3 G A 16: 21,221,382 R498H probably damaging Het
F10 T C 8: 13,055,422 I329T probably damaging Het
Fam13b G T 18: 34,445,329 Q760K possibly damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fpr-rs4 A G 17: 18,022,256 Y175C probably damaging Het
Fzd8 T A 18: 9,214,502 M528K probably damaging Het
Gcc2 A G 10: 58,286,143 H1134R possibly damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Ggn T A 7: 29,171,916 S240R probably damaging Het
Git2 C T 5: 114,749,337 W299* probably null Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm5134 T C 10: 76,004,846 F508S possibly damaging Het
Gm9923 G T 10: 72,309,660 V114L probably benign Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Heatr5a A G 12: 51,945,419 probably null Het
Hnrnpk A T 13: 58,396,186 probably null Het
Ifna4 A T 4: 88,842,074 I72F probably damaging Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Lrrc69 A G 4: 14,665,986 V324A possibly damaging Het
Mefv T C 16: 3,717,827 Q79R probably damaging Het
Mettl17 T C 14: 51,888,797 S168P probably damaging Het
Mpp4 A T 1: 59,158,652 S23T probably benign Het
Nabp1 A T 1: 51,477,845 V24D probably damaging Het
Nod2 T A 8: 88,664,208 F359Y probably damaging Het
Olfr1355 A G 10: 78,879,433 Q87R probably benign Het
Olfr1461 T C 19: 13,165,196 Y61H probably damaging Het
Olfr1511 C T 14: 52,390,580 M64I probably benign Het
Olfr2 C T 7: 107,001,135 A242T probably damaging Het
Olfr406 A T 11: 74,269,844 T152S probably damaging Het
Olfr64 T G 7: 103,893,718 S6R probably benign Het
Olfr653 C A 7: 104,579,909 L88M probably damaging Het
Olfr987 T C 2: 85,331,100 D266G probably benign Het
Pcdh18 T C 3: 49,755,951 H305R probably benign Het
Phf1 T A 17: 26,935,745 probably null Het
Pold3 T C 7: 100,088,111 K379R probably benign Het
Pou2f3 T A 9: 43,145,237 T108S probably benign Het
Prdm5 C A 6: 65,936,076 T203K probably damaging Het
Psma5 A G 3: 108,266,444 S79G probably benign Het
Psme4 T A 11: 30,832,424 S889T probably damaging Het
Ptk2 A T 15: 73,215,983 V902D possibly damaging Het
Rad54l T A 4: 116,110,357 I243F probably damaging Het
Ralgapa2 A G 2: 146,460,759 F95L probably benign Het
Rassf6 G A 5: 90,615,871 Q71* probably null Het
Ryr2 A T 13: 11,681,080 L2967H probably damaging Het
Scn5a T C 9: 119,517,413 T1058A possibly damaging Het
Sdk1 T C 5: 142,094,581 L1276P probably damaging Het
Serpina12 T G 12: 104,035,789 T223P probably damaging Het
Sh3yl1 A G 12: 30,942,788 probably null Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stam2 T C 2: 52,708,227 probably null Het
Tac2 A G 10: 127,728,480 probably null Het
Tbata G A 10: 61,183,477 D271N probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Thra T A 11: 98,763,741 D312E probably benign Het
Tlr1 T A 5: 64,925,177 I686F probably damaging Het
Tmem86b A T 7: 4,628,707 F115L probably benign Het
Tmem94 A G 11: 115,788,674 D259G possibly damaging Het
Trim69 G A 2: 122,174,475 probably null Het
Twistnb T A 12: 33,437,818 V244D probably benign Het
Usp43 T A 11: 67,904,333 Q243L probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn2r104 A T 17: 20,042,051 N272K probably damaging Het
Vmn2r26 G A 6: 124,053,887 C527Y probably damaging Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Vps13b A T 15: 35,869,407 I2686F probably damaging Het
Vps8 C T 16: 21,461,142 T281M probably damaging Het
Wdfy3 A G 5: 101,919,409 V1219A probably benign Het
Wnt9b A G 11: 103,730,812 C340R probably damaging Het
Zfhx3 T C 8: 108,794,142 V632A probably benign Het
Zfp341 A T 2: 154,638,212 T528S probably benign Het
Zfp990 G A 4: 145,534,882 A33T probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zyx A T 6: 42,351,355 K166I probably damaging Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98862333 missense unknown
IGL00927:Kmt2d APN 15 98845009 unclassified probably benign
IGL01123:Kmt2d APN 15 98837148 missense unknown
IGL01288:Kmt2d APN 15 98865044 missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98860657 unclassified probably benign
IGL01575:Kmt2d APN 15 98846855 utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98856369 unclassified probably benign
IGL01750:Kmt2d APN 15 98853168 unclassified probably benign
IGL02163:Kmt2d APN 15 98835228 unclassified probably benign
IGL02209:Kmt2d APN 15 98854567 unclassified probably benign
IGL02253:Kmt2d APN 15 98858175 unclassified probably benign
IGL02271:Kmt2d APN 15 98866428 missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98865492 splice site probably benign
IGL02448:Kmt2d APN 15 98844110 unclassified probably benign
IGL02472:Kmt2d APN 15 98850077 missense probably benign 0.23
IGL02496:Kmt2d APN 15 98857558 unclassified probably benign
IGL02527:Kmt2d APN 15 98841747 unclassified probably benign
IGL02576:Kmt2d APN 15 98864120 missense unknown
IGL02597:Kmt2d APN 15 98863831 missense unknown
IGL02609:Kmt2d APN 15 98851793 unclassified probably benign
IGL03085:Kmt2d APN 15 98839940 unclassified probably benign
IGL03102:Kmt2d APN 15 98855543 missense probably benign
IGL03123:Kmt2d APN 15 98861771 missense unknown
R0091:Kmt2d UTSW 15 98844479 unclassified probably benign
R0136:Kmt2d UTSW 15 98854278 unclassified probably benign
R0243:Kmt2d UTSW 15 98850137 unclassified probably benign
R0276:Kmt2d UTSW 15 98850311 unclassified probably benign
R0477:Kmt2d UTSW 15 98853581 unclassified probably benign
R0478:Kmt2d UTSW 15 98853581 unclassified probably benign
R0586:Kmt2d UTSW 15 98835207 unclassified probably benign
R0632:Kmt2d UTSW 15 98853581 unclassified probably benign
R0678:Kmt2d UTSW 15 98850413 unclassified probably benign
R0780:Kmt2d UTSW 15 98862857 missense unknown
R0891:Kmt2d UTSW 15 98852691 unclassified probably benign
R1136:Kmt2d UTSW 15 98857765 unclassified probably benign
R1417:Kmt2d UTSW 15 98866430 missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98844938 unclassified probably benign
R1510:Kmt2d UTSW 15 98856377 unclassified probably benign
R1586:Kmt2d UTSW 15 98865053 splice site probably benign
R1640:Kmt2d UTSW 15 98845057 unclassified probably benign
R1714:Kmt2d UTSW 15 98862950 missense unknown
R1725:Kmt2d UTSW 15 98845234 unclassified probably benign
R1728:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98845234 unclassified probably benign
R1744:Kmt2d UTSW 15 98865047 missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98864378 missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98843482 unclassified probably benign
R1782:Kmt2d UTSW 15 98857548 unclassified probably benign
R1789:Kmt2d UTSW 15 98852074 unclassified probably benign
R1802:Kmt2d UTSW 15 98862985 missense unknown
R1808:Kmt2d UTSW 15 98866686 missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98861780 missense unknown
R1831:Kmt2d UTSW 15 98855343 missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98855590 missense probably damaging 0.96
R1920:Kmt2d UTSW 15 98855591 missense probably damaging 1.00
R2100:Kmt2d UTSW 15 98846480 unclassified probably benign
R2120:Kmt2d UTSW 15 98839529 unclassified probably benign
R2188:Kmt2d UTSW 15 98839300 unclassified probably benign
R2191:Kmt2d UTSW 15 98861049 critical splice donor site probably null
R2234:Kmt2d UTSW 15 98865248 missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98862266 missense unknown
R2762:Kmt2d UTSW 15 98852055 unclassified probably benign
R2895:Kmt2d UTSW 15 98843939 unclassified probably benign
R3624:Kmt2d UTSW 15 98842902 unclassified probably benign
R3791:Kmt2d UTSW 15 98844149 unclassified probably benign
R3794:Kmt2d UTSW 15 98837359 unclassified probably benign
R3871:Kmt2d UTSW 15 98851021 unclassified probably benign
R3958:Kmt2d UTSW 15 98855549 missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98846046 unclassified probably benign
R4211:Kmt2d UTSW 15 98840189 unclassified probably benign
R4212:Kmt2d UTSW 15 98845003 unclassified probably benign
R4240:Kmt2d UTSW 15 98844571 unclassified probably benign
R4246:Kmt2d UTSW 15 98840089 unclassified probably benign
R4361:Kmt2d UTSW 15 98863670 missense unknown
R4388:Kmt2d UTSW 15 98853626 unclassified probably benign
R4602:Kmt2d UTSW 15 98850259 unclassified probably benign
R4606:Kmt2d UTSW 15 98839716 unclassified probably benign
R4658:Kmt2d UTSW 15 98852529 unclassified probably benign
R4840:Kmt2d UTSW 15 98861894 missense unknown
R4895:Kmt2d UTSW 15 98844487 unclassified probably benign
R4906:Kmt2d UTSW 15 98849539 unclassified probably benign
R4976:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98856162 missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98840224 unclassified probably benign
R5260:Kmt2d UTSW 15 98842860 unclassified probably benign
R5274:Kmt2d UTSW 15 98854230 unclassified probably benign
R5450:Kmt2d UTSW 15 98855086 missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98852109 unclassified probably benign
R5462:Kmt2d UTSW 15 98852109 unclassified probably benign
R5463:Kmt2d UTSW 15 98852109 unclassified probably benign
R5465:Kmt2d UTSW 15 98852109 unclassified probably benign
R5467:Kmt2d UTSW 15 98852109 unclassified probably benign
R5481:Kmt2d UTSW 15 98862005 missense unknown
R5509:Kmt2d UTSW 15 98839676 unclassified probably benign
R5534:Kmt2d UTSW 15 98837357 unclassified probably benign
R5536:Kmt2d UTSW 15 98852109 unclassified probably benign
R5537:Kmt2d UTSW 15 98852109 unclassified probably benign
R5538:Kmt2d UTSW 15 98852109 unclassified probably benign
R5546:Kmt2d UTSW 15 98853068 unclassified probably benign
R5595:Kmt2d UTSW 15 98850024 unclassified probably benign
R5645:Kmt2d UTSW 15 98844397 unclassified probably benign
R5679:Kmt2d UTSW 15 98854272 unclassified probably benign
R5710:Kmt2d UTSW 15 98854106 unclassified probably benign
R5755:Kmt2d UTSW 15 98863646 missense unknown
R5817:Kmt2d UTSW 15 98862363 missense unknown
R5841:Kmt2d UTSW 15 98852109 unclassified probably benign
R5842:Kmt2d UTSW 15 98852109 unclassified probably benign
R5843:Kmt2d UTSW 15 98852109 unclassified probably benign
R5844:Kmt2d UTSW 15 98852109 unclassified probably benign
R5845:Kmt2d UTSW 15 98852109 unclassified probably benign
R6122:Kmt2d UTSW 15 98860692 unclassified probably benign
R6612:Kmt2d UTSW 15 98845858 unclassified probably benign
R6718:Kmt2d UTSW 15 98849586 unclassified probably benign
R6718:Kmt2d UTSW 15 98850539 unclassified probably benign
R6822:Kmt2d UTSW 15 98849459 unclassified probably benign
R6866:Kmt2d UTSW 15 98857393 unclassified probably benign
R6950:Kmt2d UTSW 15 98840020 unclassified probably benign
R7089:Kmt2d UTSW 15 98850272 missense unknown
R7120:Kmt2d UTSW 15 98861065 missense unknown
R7131:Kmt2d UTSW 15 98849616 unclassified probably benign
R7158:Kmt2d UTSW 15 98849598 unclassified probably benign
R7177:Kmt2d UTSW 15 98850386 missense unknown
R7194:Kmt2d UTSW 15 98843833 missense unknown
R7252:Kmt2d UTSW 15 98844266 missense unknown
R7282:Kmt2d UTSW 15 98854104 missense unknown
R7307:Kmt2d UTSW 15 98849418 missense unknown
R7313:Kmt2d UTSW 15 98856623 missense unknown
X0018:Kmt2d UTSW 15 98852922 unclassified probably benign
X0024:Kmt2d UTSW 15 98853053 unclassified probably benign
X0062:Kmt2d UTSW 15 98849819 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCCACCAGACAGATGTAGT -3'
(R):5'- ATGGGCTTCTAATTGACTCCCTG -3'

Sequencing Primer
(F):5'- CTCACCTTGCTGTTGACA -3'
(R):5'- GACCTGAGTTTAAATCCCTGGGAC -3'
Posted On2014-08-01