Incidental Mutation 'R0133:Myom1'
ID21788
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0133 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71047787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 393 (V393E)
Ref Sequence ENSEMBL: ENSMUSP00000136266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect probably damaging
Transcript: ENSMUST00000024847
AA Change: V393E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: V393E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073211
AA Change: V393E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: V393E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179759
AA Change: V393E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: V393E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCAAAGCCAAGTGCAAGTGTGTG -3'
(R):5'- ACAGGTTCTGTTAGCCCTGAGAGAC -3'

Sequencing Primer
(F):5'- TCATGGGAAGTCAGCTCTAAC -3'
(R):5'- AGAGACAGATCTGCAACTGG -3'
Posted On2013-04-12