Incidental Mutation 'R1957:Olfr620'
ID217913
Institutional Source Beutler Lab
Gene Symbol Olfr620
Ensembl Gene ENSMUSG00000045132
Gene Nameolfactory receptor 620
SynonymsMOR4-1, GA_x6K02T2PBJ9-6335095-6334154
MMRRC Submission 039971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1957 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103604895-103612534 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 103611411 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Leucine at position 314 (*314L)
Ref Sequence ENSEMBL: ENSMUSP00000148869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052152] [ENSMUST00000052152] [ENSMUST00000052152] [ENSMUST00000052152] [ENSMUST00000217603]
Predicted Effect probably null
Transcript: ENSMUST00000052152
AA Change: *314L
SMART Domains Protein: ENSMUSP00000061764
Gene: ENSMUSG00000045132
AA Change: *314L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.6e-137 PFAM
Pfam:7tm_1 43 294 4.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052152
AA Change: *314L
SMART Domains Protein: ENSMUSP00000061764
Gene: ENSMUSG00000045132
AA Change: *314L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.6e-137 PFAM
Pfam:7tm_1 43 294 4.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052152
AA Change: *314L
SMART Domains Protein: ENSMUSP00000061764
Gene: ENSMUSG00000045132
AA Change: *314L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.6e-137 PFAM
Pfam:7tm_1 43 294 4.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052152
AA Change: *314L
SMART Domains Protein: ENSMUSP00000061764
Gene: ENSMUSG00000045132
AA Change: *314L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.6e-137 PFAM
Pfam:7tm_1 43 294 4.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215752
Predicted Effect probably null
Transcript: ENSMUST00000217603
AA Change: *314L
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Apc A G 18: 34,317,335 E2394G probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Daam1 T C 12: 71,982,755 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Dzip3 C A 16: 48,927,593 L1151F probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mki67 A T 7: 135,698,399 D1635E probably benign Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rbbp6 T C 7: 122,990,288 S438P probably benign Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stab2 A G 10: 86,861,470 Y1985H probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Olfr620
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02807:Olfr620 APN 7 103611991 missense probably benign 0.34
R0496:Olfr620 UTSW 7 103611997 missense probably benign 0.09
R0834:Olfr620 UTSW 7 103612237 missense probably benign 0.00
R1958:Olfr620 UTSW 7 103611411 makesense probably null
R2158:Olfr620 UTSW 7 103612236 missense possibly damaging 0.66
R3797:Olfr620 UTSW 7 103611447 missense probably benign 0.37
R5389:Olfr620 UTSW 7 103611590 nonsense probably null
R6292:Olfr620 UTSW 7 103612179 missense probably damaging 0.99
R6374:Olfr620 UTSW 7 103611921 missense probably benign 0.23
R6422:Olfr620 UTSW 7 103612014 missense probably damaging 1.00
R6586:Olfr620 UTSW 7 103611976 missense possibly damaging 0.81
R7234:Olfr620 UTSW 7 103611882 missense probably damaging 0.97
R7393:Olfr620 UTSW 7 103611991 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCTAGTTTGTGACATTAAGTACAG -3'
(R):5'- GTCTTTGCAAACATGTGTATCTCAC -3'

Sequencing Primer
(F):5'- GGAAAGCATTGTTAAACAGTAG -3'
(R):5'- TACATCCCCATCATTGGTCTGAC -3'
Posted On2014-08-01