Incidental Mutation 'R1957:Rbbp6'
ID217916
Institutional Source Beutler Lab
Gene Symbol Rbbp6
Ensembl Gene ENSMUSG00000030779
Gene Nameretinoblastoma binding protein 6, ubiquitin ligase
SynonymsC030034J04Rik, 4933422O15Rik
MMRRC Submission 039971-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1957 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122965686-123002557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122990288 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 438 (S438P)
Ref Sequence ENSEMBL: ENSMUSP00000155989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052135] [ENSMUST00000071590] [ENSMUST00000231323]
Predicted Effect probably benign
Transcript: ENSMUST00000052135
AA Change: S400P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000049528
Gene: ENSMUSG00000030779
AA Change: S400P

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
coiled coil region 653 679 N/A INTRINSIC
low complexity region 680 774 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
internal_repeat_2 1026 1091 4.38e-6 PROSPERO
internal_repeat_1 1038 1107 3.76e-7 PROSPERO
low complexity region 1120 1141 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1247 1258 N/A INTRINSIC
internal_repeat_2 1395 1466 4.38e-6 PROSPERO
low complexity region 1472 1490 N/A INTRINSIC
internal_repeat_1 1523 1586 3.76e-7 PROSPERO
low complexity region 1689 1752 N/A INTRINSIC
low complexity region 1758 1784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071590
AA Change: S400P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071519
Gene: ENSMUSG00000030779
AA Change: S400P

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
low complexity region 653 740 N/A INTRINSIC
low complexity region 790 810 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 969 991 N/A INTRINSIC
internal_repeat_2 992 1057 5.65e-6 PROSPERO
internal_repeat_1 1004 1073 5.01e-7 PROSPERO
low complexity region 1086 1107 N/A INTRINSIC
low complexity region 1109 1120 N/A INTRINSIC
low complexity region 1213 1224 N/A INTRINSIC
internal_repeat_2 1361 1432 5.65e-6 PROSPERO
low complexity region 1438 1456 N/A INTRINSIC
internal_repeat_1 1489 1552 5.01e-7 PROSPERO
low complexity region 1655 1718 N/A INTRINSIC
low complexity region 1724 1750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156738
Predicted Effect probably benign
Transcript: ENSMUST00000231323
AA Change: S438P

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, reduced size, growth retardation and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Apc A G 18: 34,317,335 E2394G probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Daam1 T C 12: 71,982,755 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Dzip3 C A 16: 48,927,593 L1151F probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mki67 A T 7: 135,698,399 D1635E probably benign Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stab2 A G 10: 86,861,470 Y1985H probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Rbbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Rbbp6 APN 7 122988685 missense probably damaging 1.00
IGL00561:Rbbp6 APN 7 122971063 missense probably damaging 1.00
IGL01144:Rbbp6 APN 7 122975946 missense possibly damaging 0.95
IGL01325:Rbbp6 APN 7 122988618 missense probably damaging 1.00
IGL01520:Rbbp6 APN 7 122985675 missense possibly damaging 0.93
IGL01765:Rbbp6 APN 7 122999954 unclassified probably benign
IGL01985:Rbbp6 APN 7 122971073 missense probably damaging 1.00
IGL02094:Rbbp6 APN 7 122997262 missense probably damaging 1.00
IGL02125:Rbbp6 APN 7 122971129 critical splice donor site probably null
IGL02552:Rbbp6 APN 7 122982981 missense probably damaging 0.98
IGL02805:Rbbp6 APN 7 123001188 utr 3 prime probably benign
changeling UTSW 7 122997311 splice site probably null
Puzzlewit UTSW 7 122999808 unclassified probably benign
R0403:Rbbp6 UTSW 7 122992296 missense probably damaging 0.99
R0855:Rbbp6 UTSW 7 122992248 missense probably benign 0.22
R1132:Rbbp6 UTSW 7 123000113 unclassified probably benign
R1463:Rbbp6 UTSW 7 122992453 missense possibly damaging 0.89
R1867:Rbbp6 UTSW 7 122997029 missense probably damaging 1.00
R1958:Rbbp6 UTSW 7 123001945 unclassified probably benign
R1978:Rbbp6 UTSW 7 122999488 unclassified probably benign
R1999:Rbbp6 UTSW 7 122990352 missense probably damaging 0.98
R2164:Rbbp6 UTSW 7 122999474 unclassified probably benign
R4181:Rbbp6 UTSW 7 122994735 missense probably damaging 0.99
R4387:Rbbp6 UTSW 7 122997311 splice site probably null
R4583:Rbbp6 UTSW 7 123001952 unclassified probably benign
R4936:Rbbp6 UTSW 7 122999703 unclassified probably benign
R4974:Rbbp6 UTSW 7 122999808 unclassified probably benign
R4998:Rbbp6 UTSW 7 122990326 missense probably benign 0.36
R5082:Rbbp6 UTSW 7 123000702 utr 3 prime probably benign
R5502:Rbbp6 UTSW 7 122988724 missense probably damaging 1.00
R5567:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5570:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5607:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5608:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5948:Rbbp6 UTSW 7 122997628 missense probably damaging 1.00
R6134:Rbbp6 UTSW 7 122997311 splice site probably null
R6172:Rbbp6 UTSW 7 122998555 nonsense probably null
R6773:Rbbp6 UTSW 7 122999355 unclassified probably benign
R6800:Rbbp6 UTSW 7 122985064 missense possibly damaging 0.93
R7266:Rbbp6 UTSW 7 123001367 missense unknown
R7298:Rbbp6 UTSW 7 123001194 missense unknown
X0062:Rbbp6 UTSW 7 123000146 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACTGGCTATACAAAACGACTACG -3'
(R):5'- AGCACAGGGGTCCATTAAAG -3'

Sequencing Primer
(F):5'- TGGCTATACAAAACGACTACGAAAAC -3'
(R):5'- TGGGTCTACATAGTGAGACCCTAC -3'
Posted On2014-08-01