Incidental Mutation 'R0134:Dnlz'
ID21797
Institutional Source Beutler Lab
Gene Symbol Dnlz
Ensembl Gene ENSMUSG00000075467
Gene NameDNL-type zinc finger
Synonyms1110034G11Rik, D2Bwg1335e
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R0134 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location26348121-26352110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26351368 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 116 (N116S)
Ref Sequence ENSEMBL: ENSMUSP00000028295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000028295] [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000100303] [ENSMUST00000114134]
Predicted Effect probably benign
Transcript: ENSMUST00000028294
SMART Domains Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928

DomainStartEndE-ValueType
Pfam:CARD 11 97 3.1e-21 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000028295
AA Change: N116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028295
Gene: ENSMUSG00000075467
AA Change: N116S

DomainStartEndE-ValueType
low complexity region 38 67 N/A INTRINSIC
Pfam:zf-DNL 74 139 4.1e-34 PFAM
low complexity region 158 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066889
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066936
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078616
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100303
SMART Domains Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928

DomainStartEndE-ValueType
Pfam:CARD 11 97 7.1e-22 PFAM
coiled coil region 145 272 N/A INTRINSIC
coiled coil region 375 415 N/A INTRINSIC
low complexity region 482 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114134
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142057
Predicted Effect probably benign
Transcript: ENSMUST00000145884
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153370
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Dnlz
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Dnlz UTSW 2 26351368 missense probably damaging 1.00
R0225:Dnlz UTSW 2 26351368 missense probably damaging 1.00
R0799:Dnlz UTSW 2 26351473 missense possibly damaging 0.91
R2273:Dnlz UTSW 2 26351471 missense probably damaging 1.00
R2274:Dnlz UTSW 2 26351471 missense probably damaging 1.00
R2275:Dnlz UTSW 2 26351471 missense probably damaging 1.00
R5750:Dnlz UTSW 2 26351411 missense probably damaging 1.00
X0026:Dnlz UTSW 2 26350554 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCCACTGATCCCTCCTCATAGAAC -3'
(R):5'- AGAGACTTTCCTGTGTATGCCTTGC -3'

Sequencing Primer
(F):5'- CACTAGAGATTGATAAGGCCCCTG -3'
(R):5'- GTGTATGCCTTGCCTGACC -3'
Posted On2013-04-12