Incidental Mutation 'R1957:Apc'
ID217978
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
MMRRC Submission 039971-MU
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1957 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34317335 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2394 (E2394G)
Ref Sequence ENSEMBL: ENSMUSP00000111447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
Predicted Effect probably damaging
Transcript: ENSMUST00000079362
AA Change: E2428G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: E2428G

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115781
AA Change: E2394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: E2394G

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171187
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Daam1 T C 12: 71,982,755 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Dzip3 C A 16: 48,927,593 L1151F probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mki67 A T 7: 135,698,399 D1635E probably benign Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rbbp6 T C 7: 122,990,288 S438P probably benign Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stab2 A G 10: 86,861,470 Y1985H probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 splice site probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 intron probably benign
FR4342:Apc UTSW 18 34281999 intron probably benign
FR4449:Apc UTSW 18 34282000 intron probably benign
FR4449:Apc UTSW 18 34282005 intron probably benign
FR4548:Apc UTSW 18 34281998 intron probably benign
FR4737:Apc UTSW 18 34281999 intron probably benign
FR4976:Apc UTSW 18 34281998 intron probably benign
FR4976:Apc UTSW 18 34282000 intron probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1737:Apc UTSW 18 34317022 missense probably damaging 1.00
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1887:Apc UTSW 18 34272468 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably null
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2017:Apc UTSW 18 34313602 missense probably benign 0.00
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4611:Apc UTSW 18 34318565 missense probably damaging 1.00
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 unclassified probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
R6974:Apc UTSW 18 34298427 missense possibly damaging 0.65
R7027:Apc UTSW 18 34312076 missense probably damaging 1.00
R7096:Apc UTSW 18 34315957 missense probably damaging 1.00
R7289:Apc UTSW 18 34315271 missense probably damaging 1.00
R7439:Apc UTSW 18 34312073 missense probably damaging 1.00
R7441:Apc UTSW 18 34312073 missense probably damaging 1.00
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTACTGCTTCAACTAAGTC -3'
(R):5'- AAAACTGGGGTCTGTGCCTG -3'

Sequencing Primer
(F):5'- AAGTCCTCCGGTTCTGGGAAAATG -3'
(R):5'- TGCGACCTGGTGGGAGAATC -3'
Posted On2014-08-01