Incidental Mutation 'R1958:Noxa1'
ID217992
Institutional Source Beutler Lab
Gene Symbol Noxa1
Ensembl Gene ENSMUSG00000036805
Gene NameNADPH oxidase activator 1
Synonyms
MMRRC Submission 039972-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1958 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25085667-25095149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25090608 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 130 (S130P)
Ref Sequence ENSEMBL: ENSMUSP00000110014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044018] [ENSMUST00000044078] [ENSMUST00000114373] [ENSMUST00000114376] [ENSMUST00000114380]
Predicted Effect probably damaging
Transcript: ENSMUST00000044018
AA Change: S130P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037423
Gene: ENSMUSG00000036805
AA Change: S130P

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
PB1 285 365 6.76e-9 SMART
SH3 372 427 1.81e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044078
SMART Domains Protein: ENSMUSP00000040628
Gene: ENSMUSG00000036813

DomainStartEndE-ValueType
Pfam:GDA1_CD39 34 463 1.8e-106 PFAM
transmembrane domain 472 494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114373
AA Change: S130P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110014
Gene: ENSMUSG00000036805
AA Change: S130P

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
PB1 277 357 6.76e-9 SMART
SH3 364 419 1.81e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114376
SMART Domains Protein: ENSMUSP00000110017
Gene: ENSMUSG00000036813

DomainStartEndE-ValueType
Pfam:GDA1_CD39 34 355 1.4e-77 PFAM
Pfam:GDA1_CD39 347 423 2.1e-11 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114380
SMART Domains Protein: ENSMUSP00000110022
Gene: ENSMUSG00000036813

DomainStartEndE-ValueType
Pfam:GDA1_CD39 34 465 1.1e-100 PFAM
transmembrane domain 472 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152326
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which activates NADPH oxidases, enzymes which catalyze a reaction generating reactive oxygen species. The encoded protein contains four N-terminal tetratricopeptide domains and a C-terminal Src homology 3 domain. Interaction between the encoded protein and proteins in the oxidase regulatory complex occur via the tetratricopeptide domains. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele removing exons 3 through 6 exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,538,909 N155I probably benign Het
Abca14 A G 7: 120,325,159 Y1678C probably damaging Het
Adamts19 A T 18: 58,970,006 R706S probably benign Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Adss A G 1: 177,769,978 I372T probably damaging Het
Arhgap15 T A 2: 44,243,124 D347E possibly damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Asb8 T C 15: 98,136,216 T153A possibly damaging Het
Aspscr1 G T 11: 120,689,208 G191V probably null Het
Atm T C 9: 53,471,418 H1957R probably damaging Het
Atp13a5 A G 16: 29,314,601 Y411H probably damaging Het
Cadm1 T G 9: 47,850,335 I411S probably damaging Het
Cdh23 T A 10: 60,410,873 M927L probably benign Het
Cdk15 A T 1: 59,344,316 R423W probably damaging Het
Cep250 T A 2: 155,976,381 probably null Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Cfap54 T C 10: 92,997,342 S1141G probably benign Het
Clnk T C 5: 38,706,626 Y428C possibly damaging Het
Cnksr1 A G 4: 134,228,416 S668P probably benign Het
Cpxm2 A T 7: 132,062,147 I349N probably damaging Het
Csmd3 A G 15: 48,004,639 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dph2 A T 4: 117,891,844 F5I probably damaging Het
Dst T A 1: 34,163,721 F325L probably damaging Het
Edem3 T C 1: 151,804,325 L474S probably damaging Het
Emilin1 T A 5: 30,917,816 L467Q probably benign Het
Fam170a G A 18: 50,282,114 E276K probably benign Het
Farp1 A T 14: 121,219,375 probably null Het
Fbrs A T 7: 127,485,991 T584S possibly damaging Het
Fbxo22 T A 9: 55,209,342 probably null Het
Fhod3 T G 18: 25,090,465 L956R probably damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm11444 A T 11: 85,848,173 probably benign Het
Gm14443 T C 2: 175,169,704 I316M probably benign Het
Gm4758 T C 16: 36,312,565 L68P possibly damaging Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Hdhd2 A G 18: 76,965,145 T164A probably benign Het
Hoxb9 T A 11: 96,272,054 D171E possibly damaging Het
Hpx A G 7: 105,596,396 Y118H probably damaging Het
Iqsec1 T C 6: 90,670,459 K858E probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lama2 C A 10: 26,981,598 R3085L probably damaging Het
Lyst C A 13: 13,616,618 A22E probably damaging Het
Man2a1 T C 17: 64,750,835 F1079L probably benign Het
Marco C T 1: 120,484,864 G303R probably damaging Het
Marveld2 A C 13: 100,597,350 I536R probably damaging Het
Mcm5 A G 8: 75,121,629 D502G probably benign Het
Mdga1 A T 17: 29,840,888 L653Q probably damaging Het
Micalcl A G 7: 112,381,104 D161G probably benign Het
Mroh2a C T 1: 88,237,491 R445* probably null Het
Mrpl46 A T 7: 78,781,398 probably null Het
Nckipsd C A 9: 108,814,664 probably null Het
Nek11 T C 9: 105,293,717 D373G probably benign Het
Nle1 G A 11: 82,904,242 S321F probably benign Het
Olfr1156 A T 2: 87,949,465 L256H probably damaging Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr713 A G 7: 107,036,271 T39A possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Parp3 T G 9: 106,474,822 probably null Het
Pask A T 1: 93,321,458 I740N probably benign Het
Pelp1 A G 11: 70,398,521 F221S probably damaging Het
Pkd1l1 T G 11: 8,874,161 K1135Q probably benign Het
Plcl2 A T 17: 50,608,081 Q706L probably damaging Het
Psg26 T C 7: 18,478,339 T364A probably benign Het
Ptprb C T 10: 116,341,536 T1047M probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab37 C T 11: 115,160,351 A155V probably damaging Het
Rbbp6 A C 7: 123,001,945 probably benign Het
Rbmxl2 A G 7: 107,210,198 D230G probably benign Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,908 probably benign Het
Sass6 G T 3: 116,610,296 K194N possibly damaging Het
Sgpp1 T G 12: 75,735,448 D39A probably benign Het
Shank3 T C 15: 89,503,148 V198A probably damaging Het
Sin3a T A 9: 57,105,609 S591T probably damaging Het
Slc12a6 C T 2: 112,355,158 T924I possibly damaging Het
Sln T A 9: 53,853,501 I10N probably benign Het
St3gal3 A T 4: 117,940,071 M309K probably damaging Het
Syne2 T A 12: 75,969,545 D3301E probably benign Het
Tgtp2 A G 11: 49,059,092 S218P probably damaging Het
Tha1 C T 11: 117,869,353 probably benign Het
Tmem102 A G 11: 69,804,399 V249A probably benign Het
Top3b G A 16: 16,884,302 E268K possibly damaging Het
Trip4 T C 9: 65,839,025 S530G possibly damaging Het
Tut1 T A 19: 8,959,313 V167E probably damaging Het
Ube2u A T 4: 100,481,636 M33L probably benign Het
Unc79 T C 12: 102,991,362 I12T probably damaging Het
Unc79 A T 12: 103,074,919 D737V probably benign Het
Vmn1r26 A G 6: 58,008,301 V301A probably benign Het
Vmn1r86 A G 7: 13,102,694 V35A possibly damaging Het
Vmn2r98 A C 17: 19,066,418 N393H possibly damaging Het
Vps13b T G 15: 35,878,689 S2945A probably damaging Het
Whrn C T 4: 63,435,429 R367H possibly damaging Het
Zcchc11 A T 4: 108,555,706 S1535C probably damaging Het
Zfp235 A T 7: 24,140,346 L133F probably damaging Het
Zfp74 T C 7: 29,935,711 T191A probably benign Het
Zfp943 A T 17: 21,992,998 K355I probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zscan29 A T 2: 121,169,808 probably null Het
Other mutations in Noxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Noxa1 APN 2 25094902 missense probably benign 0.37
IGL01316:Noxa1 APN 2 25086011 missense probably benign 0.22
IGL02274:Noxa1 APN 2 25085755 missense probably benign 0.15
IGL02528:Noxa1 APN 2 25090633 unclassified probably benign
IGL02952:Noxa1 APN 2 25091761 missense probably damaging 1.00
IGL03286:Noxa1 APN 2 25085720 unclassified probably null
IGL03330:Noxa1 APN 2 25090514 missense possibly damaging 0.48
R0322:Noxa1 UTSW 2 25092554 missense probably damaging 1.00
R0357:Noxa1 UTSW 2 25085850 missense probably damaging 1.00
R0636:Noxa1 UTSW 2 25086094 unclassified probably benign
R0909:Noxa1 UTSW 2 25091794 missense probably damaging 1.00
R1459:Noxa1 UTSW 2 25092546 missense probably benign 0.06
R1702:Noxa1 UTSW 2 25092584 missense probably damaging 1.00
R4618:Noxa1 UTSW 2 25091749 missense probably damaging 1.00
R5104:Noxa1 UTSW 2 25086234 missense probably benign 0.18
R5606:Noxa1 UTSW 2 25086280 missense possibly damaging 0.67
R5619:Noxa1 UTSW 2 25085976 missense probably damaging 0.99
R5826:Noxa1 UTSW 2 25086241 missense probably damaging 0.98
R6076:Noxa1 UTSW 2 25085809 missense probably damaging 1.00
R6920:Noxa1 UTSW 2 25091832 splice site probably null
X0021:Noxa1 UTSW 2 25090214 missense possibly damaging 0.95
X0025:Noxa1 UTSW 2 25090491 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGGAAGTATGAGGCACCC -3'
(R):5'- GTCTTGTCGAACCTTCAGCTAC -3'

Sequencing Primer
(F):5'- TCGTTTTGAAGGAGTAAGCTAGAG -3'
(R):5'- GAACCTTCAGCTACTGTAACTGGG -3'
Posted On2014-08-01