Incidental Mutation 'R1958:Lama2'
ID218047
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 039972-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R1958 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26981598 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 3085 (R3085L)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
PDB Structure
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000092639
AA Change: R3085L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: R3085L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186279
Predicted Effect unknown
Transcript: ENSMUST00000219763
AA Change: R1093L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220276
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,538,909 N155I probably benign Het
Abca14 A G 7: 120,325,159 Y1678C probably damaging Het
Adamts19 A T 18: 58,970,006 R706S probably benign Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Adss A G 1: 177,769,978 I372T probably damaging Het
Arhgap15 T A 2: 44,243,124 D347E possibly damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Asb8 T C 15: 98,136,216 T153A possibly damaging Het
Aspscr1 G T 11: 120,689,208 G191V probably null Het
Atm T C 9: 53,471,418 H1957R probably damaging Het
Atp13a5 A G 16: 29,314,601 Y411H probably damaging Het
Cadm1 T G 9: 47,850,335 I411S probably damaging Het
Cdh23 T A 10: 60,410,873 M927L probably benign Het
Cdk15 A T 1: 59,344,316 R423W probably damaging Het
Cep250 T A 2: 155,976,381 probably null Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Cfap54 T C 10: 92,997,342 S1141G probably benign Het
Clnk T C 5: 38,706,626 Y428C possibly damaging Het
Cnksr1 A G 4: 134,228,416 S668P probably benign Het
Cpxm2 A T 7: 132,062,147 I349N probably damaging Het
Csmd3 A G 15: 48,004,639 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dph2 A T 4: 117,891,844 F5I probably damaging Het
Dst T A 1: 34,163,721 F325L probably damaging Het
Edem3 T C 1: 151,804,325 L474S probably damaging Het
Emilin1 T A 5: 30,917,816 L467Q probably benign Het
Fam170a G A 18: 50,282,114 E276K probably benign Het
Farp1 A T 14: 121,219,375 probably null Het
Fbrs A T 7: 127,485,991 T584S possibly damaging Het
Fbxo22 T A 9: 55,209,342 probably null Het
Fhod3 T G 18: 25,090,465 L956R probably damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm11444 A T 11: 85,848,173 probably benign Het
Gm14443 T C 2: 175,169,704 I316M probably benign Het
Gm4758 T C 16: 36,312,565 L68P possibly damaging Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Hdhd2 A G 18: 76,965,145 T164A probably benign Het
Hoxb9 T A 11: 96,272,054 D171E possibly damaging Het
Hpx A G 7: 105,596,396 Y118H probably damaging Het
Iqsec1 T C 6: 90,670,459 K858E probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lyst C A 13: 13,616,618 A22E probably damaging Het
Man2a1 T C 17: 64,750,835 F1079L probably benign Het
Marco C T 1: 120,484,864 G303R probably damaging Het
Marveld2 A C 13: 100,597,350 I536R probably damaging Het
Mcm5 A G 8: 75,121,629 D502G probably benign Het
Mdga1 A T 17: 29,840,888 L653Q probably damaging Het
Micalcl A G 7: 112,381,104 D161G probably benign Het
Mroh2a C T 1: 88,237,491 R445* probably null Het
Mrpl46 A T 7: 78,781,398 probably null Het
Nckipsd C A 9: 108,814,664 probably null Het
Nek11 T C 9: 105,293,717 D373G probably benign Het
Nle1 G A 11: 82,904,242 S321F probably benign Het
Noxa1 A G 2: 25,090,608 S130P probably damaging Het
Olfr1156 A T 2: 87,949,465 L256H probably damaging Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr713 A G 7: 107,036,271 T39A possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Parp3 T G 9: 106,474,822 probably null Het
Pask A T 1: 93,321,458 I740N probably benign Het
Pelp1 A G 11: 70,398,521 F221S probably damaging Het
Pkd1l1 T G 11: 8,874,161 K1135Q probably benign Het
Plcl2 A T 17: 50,608,081 Q706L probably damaging Het
Psg26 T C 7: 18,478,339 T364A probably benign Het
Ptprb C T 10: 116,341,536 T1047M probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab37 C T 11: 115,160,351 A155V probably damaging Het
Rbbp6 A C 7: 123,001,945 probably benign Het
Rbmxl2 A G 7: 107,210,198 D230G probably benign Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,908 probably benign Het
Sass6 G T 3: 116,610,296 K194N possibly damaging Het
Sgpp1 T G 12: 75,735,448 D39A probably benign Het
Shank3 T C 15: 89,503,148 V198A probably damaging Het
Sin3a T A 9: 57,105,609 S591T probably damaging Het
Slc12a6 C T 2: 112,355,158 T924I possibly damaging Het
Sln T A 9: 53,853,501 I10N probably benign Het
St3gal3 A T 4: 117,940,071 M309K probably damaging Het
Syne2 T A 12: 75,969,545 D3301E probably benign Het
Tgtp2 A G 11: 49,059,092 S218P probably damaging Het
Tha1 C T 11: 117,869,353 probably benign Het
Tmem102 A G 11: 69,804,399 V249A probably benign Het
Top3b G A 16: 16,884,302 E268K possibly damaging Het
Trip4 T C 9: 65,839,025 S530G possibly damaging Het
Tut1 T A 19: 8,959,313 V167E probably damaging Het
Ube2u A T 4: 100,481,636 M33L probably benign Het
Unc79 T C 12: 102,991,362 I12T probably damaging Het
Unc79 A T 12: 103,074,919 D737V probably benign Het
Vmn1r26 A G 6: 58,008,301 V301A probably benign Het
Vmn1r86 A G 7: 13,102,694 V35A possibly damaging Het
Vmn2r98 A C 17: 19,066,418 N393H possibly damaging Het
Vps13b T G 15: 35,878,689 S2945A probably damaging Het
Whrn C T 4: 63,435,429 R367H possibly damaging Het
Zcchc11 A T 4: 108,555,706 S1535C probably damaging Het
Zfp235 A T 7: 24,140,346 L133F probably damaging Het
Zfp74 T C 7: 29,935,711 T191A probably benign Het
Zfp943 A T 17: 21,992,998 K355I probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zscan29 A T 2: 121,169,808 probably null Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCTGACACCGTGCAGAAAG -3'
(R):5'- AAACAATGGTCGACCTGGTGG -3'

Sequencing Primer
(F):5'- GACACCGTGCAGAAAGAATTTTATG -3'
(R):5'- GTAGGGTTCTTGTGCAGCATG -3'
Posted On2014-08-01