Incidental Mutation 'R1958:Vps13b'
ID218068
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Namevacuolar protein sorting 13B
Synonyms2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 039972-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R1958 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location35371160-35931229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 35878689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 2945 (S2945A)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: S2945A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: S2945A

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228738
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,538,909 N155I probably benign Het
Abca14 A G 7: 120,325,159 Y1678C probably damaging Het
Adamts19 A T 18: 58,970,006 R706S probably benign Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Adss A G 1: 177,769,978 I372T probably damaging Het
Arhgap15 T A 2: 44,243,124 D347E possibly damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Asb8 T C 15: 98,136,216 T153A possibly damaging Het
Aspscr1 G T 11: 120,689,208 G191V probably null Het
Atm T C 9: 53,471,418 H1957R probably damaging Het
Atp13a5 A G 16: 29,314,601 Y411H probably damaging Het
Cadm1 T G 9: 47,850,335 I411S probably damaging Het
Cdh23 T A 10: 60,410,873 M927L probably benign Het
Cdk15 A T 1: 59,344,316 R423W probably damaging Het
Cep250 T A 2: 155,976,381 probably null Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Cfap54 T C 10: 92,997,342 S1141G probably benign Het
Clnk T C 5: 38,706,626 Y428C possibly damaging Het
Cnksr1 A G 4: 134,228,416 S668P probably benign Het
Cpxm2 A T 7: 132,062,147 I349N probably damaging Het
Csmd3 A G 15: 48,004,639 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dph2 A T 4: 117,891,844 F5I probably damaging Het
Dst T A 1: 34,163,721 F325L probably damaging Het
Edem3 T C 1: 151,804,325 L474S probably damaging Het
Emilin1 T A 5: 30,917,816 L467Q probably benign Het
Fam170a G A 18: 50,282,114 E276K probably benign Het
Farp1 A T 14: 121,219,375 probably null Het
Fbrs A T 7: 127,485,991 T584S possibly damaging Het
Fbxo22 T A 9: 55,209,342 probably null Het
Fhod3 T G 18: 25,090,465 L956R probably damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm11444 A T 11: 85,848,173 probably benign Het
Gm14443 T C 2: 175,169,704 I316M probably benign Het
Gm4758 T C 16: 36,312,565 L68P possibly damaging Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Hdhd2 A G 18: 76,965,145 T164A probably benign Het
Hoxb9 T A 11: 96,272,054 D171E possibly damaging Het
Hpx A G 7: 105,596,396 Y118H probably damaging Het
Iqsec1 T C 6: 90,670,459 K858E probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lama2 C A 10: 26,981,598 R3085L probably damaging Het
Lyst C A 13: 13,616,618 A22E probably damaging Het
Man2a1 T C 17: 64,750,835 F1079L probably benign Het
Marco C T 1: 120,484,864 G303R probably damaging Het
Marveld2 A C 13: 100,597,350 I536R probably damaging Het
Mcm5 A G 8: 75,121,629 D502G probably benign Het
Mdga1 A T 17: 29,840,888 L653Q probably damaging Het
Micalcl A G 7: 112,381,104 D161G probably benign Het
Mroh2a C T 1: 88,237,491 R445* probably null Het
Mrpl46 A T 7: 78,781,398 probably null Het
Nckipsd C A 9: 108,814,664 probably null Het
Nek11 T C 9: 105,293,717 D373G probably benign Het
Nle1 G A 11: 82,904,242 S321F probably benign Het
Noxa1 A G 2: 25,090,608 S130P probably damaging Het
Olfr1156 A T 2: 87,949,465 L256H probably damaging Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr713 A G 7: 107,036,271 T39A possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Parp3 T G 9: 106,474,822 probably null Het
Pask A T 1: 93,321,458 I740N probably benign Het
Pelp1 A G 11: 70,398,521 F221S probably damaging Het
Pkd1l1 T G 11: 8,874,161 K1135Q probably benign Het
Plcl2 A T 17: 50,608,081 Q706L probably damaging Het
Psg26 T C 7: 18,478,339 T364A probably benign Het
Ptprb C T 10: 116,341,536 T1047M probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab37 C T 11: 115,160,351 A155V probably damaging Het
Rbbp6 A C 7: 123,001,945 probably benign Het
Rbmxl2 A G 7: 107,210,198 D230G probably benign Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,908 probably benign Het
Sass6 G T 3: 116,610,296 K194N possibly damaging Het
Sgpp1 T G 12: 75,735,448 D39A probably benign Het
Shank3 T C 15: 89,503,148 V198A probably damaging Het
Sin3a T A 9: 57,105,609 S591T probably damaging Het
Slc12a6 C T 2: 112,355,158 T924I possibly damaging Het
Sln T A 9: 53,853,501 I10N probably benign Het
St3gal3 A T 4: 117,940,071 M309K probably damaging Het
Syne2 T A 12: 75,969,545 D3301E probably benign Het
Tgtp2 A G 11: 49,059,092 S218P probably damaging Het
Tha1 C T 11: 117,869,353 probably benign Het
Tmem102 A G 11: 69,804,399 V249A probably benign Het
Top3b G A 16: 16,884,302 E268K possibly damaging Het
Trip4 T C 9: 65,839,025 S530G possibly damaging Het
Tut1 T A 19: 8,959,313 V167E probably damaging Het
Ube2u A T 4: 100,481,636 M33L probably benign Het
Unc79 T C 12: 102,991,362 I12T probably damaging Het
Unc79 A T 12: 103,074,919 D737V probably benign Het
Vmn1r26 A G 6: 58,008,301 V301A probably benign Het
Vmn1r86 A G 7: 13,102,694 V35A possibly damaging Het
Vmn2r98 A C 17: 19,066,418 N393H possibly damaging Het
Whrn C T 4: 63,435,429 R367H possibly damaging Het
Zcchc11 A T 4: 108,555,706 S1535C probably damaging Het
Zfp235 A T 7: 24,140,346 L133F probably damaging Het
Zfp74 T C 7: 29,935,711 T191A probably benign Het
Zfp943 A T 17: 21,992,998 K355I probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zscan29 A T 2: 121,169,808 probably null Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense not run
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAAAGCTGCTTTCTCCTGC -3'
(R):5'- GTTAAGATGTACGTGTAACCTCAG -3'

Sequencing Primer
(F):5'- CAAGTGCAACCCTGGGTGAG -3'
(R):5'- TGCCAGCAGGAACTTGTA -3'
Posted On2014-08-01