Incidental Mutation 'R1958:Mdga1'
ID218077
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms
MMRRC Submission 039972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1958 (G1)
Quality Score193
Status Not validated
Chromosome17
Chromosomal Location29827956-29970087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29840888 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 653 (L653Q)
Ref Sequence ENSEMBL: ENSMUSP00000126529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]
Predicted Effect probably benign
Transcript: ENSMUST00000073556
AA Change: L653Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: L653Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165528
Predicted Effect probably benign
Transcript: ENSMUST00000167190
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168044
SMART Domains Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
Pfam:MAM 47 186 3.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171691
AA Change: L653Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: L653Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,538,909 N155I probably benign Het
Abca14 A G 7: 120,325,159 Y1678C probably damaging Het
Adamts19 A T 18: 58,970,006 R706S probably benign Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Adss A G 1: 177,769,978 I372T probably damaging Het
Arhgap15 T A 2: 44,243,124 D347E possibly damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Asb8 T C 15: 98,136,216 T153A possibly damaging Het
Aspscr1 G T 11: 120,689,208 G191V probably null Het
Atm T C 9: 53,471,418 H1957R probably damaging Het
Atp13a5 A G 16: 29,314,601 Y411H probably damaging Het
Cadm1 T G 9: 47,850,335 I411S probably damaging Het
Cdh23 T A 10: 60,410,873 M927L probably benign Het
Cdk15 A T 1: 59,344,316 R423W probably damaging Het
Cep250 T A 2: 155,976,381 probably null Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Cfap54 T C 10: 92,997,342 S1141G probably benign Het
Clnk T C 5: 38,706,626 Y428C possibly damaging Het
Cnksr1 A G 4: 134,228,416 S668P probably benign Het
Cpxm2 A T 7: 132,062,147 I349N probably damaging Het
Csmd3 A G 15: 48,004,639 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dph2 A T 4: 117,891,844 F5I probably damaging Het
Dst T A 1: 34,163,721 F325L probably damaging Het
Edem3 T C 1: 151,804,325 L474S probably damaging Het
Emilin1 T A 5: 30,917,816 L467Q probably benign Het
Fam170a G A 18: 50,282,114 E276K probably benign Het
Farp1 A T 14: 121,219,375 probably null Het
Fbrs A T 7: 127,485,991 T584S possibly damaging Het
Fbxo22 T A 9: 55,209,342 probably null Het
Fhod3 T G 18: 25,090,465 L956R probably damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm11444 A T 11: 85,848,173 probably benign Het
Gm14443 T C 2: 175,169,704 I316M probably benign Het
Gm4758 T C 16: 36,312,565 L68P possibly damaging Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Hdhd2 A G 18: 76,965,145 T164A probably benign Het
Hoxb9 T A 11: 96,272,054 D171E possibly damaging Het
Hpx A G 7: 105,596,396 Y118H probably damaging Het
Iqsec1 T C 6: 90,670,459 K858E probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lama2 C A 10: 26,981,598 R3085L probably damaging Het
Lyst C A 13: 13,616,618 A22E probably damaging Het
Man2a1 T C 17: 64,750,835 F1079L probably benign Het
Marco C T 1: 120,484,864 G303R probably damaging Het
Marveld2 A C 13: 100,597,350 I536R probably damaging Het
Mcm5 A G 8: 75,121,629 D502G probably benign Het
Micalcl A G 7: 112,381,104 D161G probably benign Het
Mroh2a C T 1: 88,237,491 R445* probably null Het
Mrpl46 A T 7: 78,781,398 probably null Het
Nckipsd C A 9: 108,814,664 probably null Het
Nek11 T C 9: 105,293,717 D373G probably benign Het
Nle1 G A 11: 82,904,242 S321F probably benign Het
Noxa1 A G 2: 25,090,608 S130P probably damaging Het
Olfr1156 A T 2: 87,949,465 L256H probably damaging Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr713 A G 7: 107,036,271 T39A possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Parp3 T G 9: 106,474,822 probably null Het
Pask A T 1: 93,321,458 I740N probably benign Het
Pelp1 A G 11: 70,398,521 F221S probably damaging Het
Pkd1l1 T G 11: 8,874,161 K1135Q probably benign Het
Plcl2 A T 17: 50,608,081 Q706L probably damaging Het
Psg26 T C 7: 18,478,339 T364A probably benign Het
Ptprb C T 10: 116,341,536 T1047M probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab37 C T 11: 115,160,351 A155V probably damaging Het
Rbbp6 A C 7: 123,001,945 probably benign Het
Rbmxl2 A G 7: 107,210,198 D230G probably benign Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,908 probably benign Het
Sass6 G T 3: 116,610,296 K194N possibly damaging Het
Sgpp1 T G 12: 75,735,448 D39A probably benign Het
Shank3 T C 15: 89,503,148 V198A probably damaging Het
Sin3a T A 9: 57,105,609 S591T probably damaging Het
Slc12a6 C T 2: 112,355,158 T924I possibly damaging Het
Sln T A 9: 53,853,501 I10N probably benign Het
St3gal3 A T 4: 117,940,071 M309K probably damaging Het
Syne2 T A 12: 75,969,545 D3301E probably benign Het
Tgtp2 A G 11: 49,059,092 S218P probably damaging Het
Tha1 C T 11: 117,869,353 probably benign Het
Tmem102 A G 11: 69,804,399 V249A probably benign Het
Top3b G A 16: 16,884,302 E268K possibly damaging Het
Trip4 T C 9: 65,839,025 S530G possibly damaging Het
Tut1 T A 19: 8,959,313 V167E probably damaging Het
Ube2u A T 4: 100,481,636 M33L probably benign Het
Unc79 T C 12: 102,991,362 I12T probably damaging Het
Unc79 A T 12: 103,074,919 D737V probably benign Het
Vmn1r26 A G 6: 58,008,301 V301A probably benign Het
Vmn1r86 A G 7: 13,102,694 V35A possibly damaging Het
Vmn2r98 A C 17: 19,066,418 N393H possibly damaging Het
Vps13b T G 15: 35,878,689 S2945A probably damaging Het
Whrn C T 4: 63,435,429 R367H possibly damaging Het
Zcchc11 A T 4: 108,555,706 S1535C probably damaging Het
Zfp235 A T 7: 24,140,346 L133F probably damaging Het
Zfp74 T C 7: 29,935,711 T191A probably benign Het
Zfp943 A T 17: 21,992,998 K355I probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zscan29 A T 2: 121,169,808 probably null Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 29843127 missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 29839871 missense probably damaging 1.00
IGL02130:Mdga1 APN 17 29857669 missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 29832405 splice site probably benign
IGL03258:Mdga1 APN 17 29839913 missense probably damaging 1.00
R0184:Mdga1 UTSW 17 29852442 missense probably damaging 1.00
R0366:Mdga1 UTSW 17 29857708 missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 29850548 missense probably damaging 0.98
R1520:Mdga1 UTSW 17 29846519 missense probably benign 0.12
R1545:Mdga1 UTSW 17 29842902 missense probably damaging 1.00
R1549:Mdga1 UTSW 17 29837998 missense probably damaging 1.00
R1671:Mdga1 UTSW 17 29850629 missense probably damaging 1.00
R1875:Mdga1 UTSW 17 29852607 missense probably damaging 1.00
R1893:Mdga1 UTSW 17 29849226 missense probably damaging 1.00
R1983:Mdga1 UTSW 17 29850605 missense probably damaging 1.00
R2014:Mdga1 UTSW 17 29849313 missense probably damaging 1.00
R2894:Mdga1 UTSW 17 29852504 missense probably damaging 1.00
R2964:Mdga1 UTSW 17 29852468 missense probably damaging 1.00
R3813:Mdga1 UTSW 17 29838479 missense probably damaging 1.00
R3938:Mdga1 UTSW 17 29857622 missense probably damaging 1.00
R3982:Mdga1 UTSW 17 29931264 missense unknown
R4063:Mdga1 UTSW 17 29838031 missense probably damaging 1.00
R4157:Mdga1 UTSW 17 29833343 missense probably benign 0.32
R4183:Mdga1 UTSW 17 29969990 missense unknown
R4392:Mdga1 UTSW 17 29850656 missense probably damaging 1.00
R4393:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4396:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4806:Mdga1 UTSW 17 29842154 missense probably benign 0.20
R4829:Mdga1 UTSW 17 29846369 missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 29838078 missense probably damaging 0.99
R4932:Mdga1 UTSW 17 29857606 missense probably damaging 1.00
R5015:Mdga1 UTSW 17 29839873 missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 29850554 missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 29852493 missense probably benign 0.43
R5180:Mdga1 UTSW 17 29857736 splice site probably benign
R5590:Mdga1 UTSW 17 29839867 missense probably damaging 1.00
R5747:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R5748:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R6207:Mdga1 UTSW 17 29838517 missense probably damaging 1.00
R6826:Mdga1 UTSW 17 29970026 missense unknown
R6831:Mdga1 UTSW 17 29887516 nonsense probably null
R7114:Mdga1 UTSW 17 29842842 splice site probably null
R7147:Mdga1 UTSW 17 29846521 nonsense probably null
R7273:Mdga1 UTSW 17 29969938 missense unknown
R7413:Mdga1 UTSW 17 29850673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCAAGACAGAAGGGGCC -3'
(R):5'- TTGGGACTTACAATCTGCCCC -3'

Sequencing Primer
(F):5'- CGGTGTCTGGGAACTCCTC -3'
(R):5'- GACTTACAATCTGCCCCCTCCATC -3'
Posted On2014-08-01