Incidental Mutation 'R1959:Zfp335'
ID218116
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1959 (G1)
Quality Score210
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164894802 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 971 (G971D)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect probably damaging
Transcript: ENSMUST00000041361
AA Change: G971D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: G971D

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Lama2 G T 10: 27,422,618 P161T probably damaging Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Sec16a A T 2: 26,430,132 H1431Q probably benign Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tanc2 T A 11: 105,910,295 H1112Q probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Traf7 C A 17: 24,513,281 G191C probably damaging Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGAAAGGCCTCTGAGCAC -3'
(R):5'- TGGCACCCACTACATCATG -3'

Sequencing Primer
(F):5'- CACACCTTGCAGGAAAACTTCTTTG -3'
(R):5'- CACTACATCATGGCAGCTGATGG -3'
Posted On2014-08-01