Incidental Mutation 'R1959:Wnk1'
ID218143
Institutional Source Beutler Lab
Gene Symbol Wnk1
Ensembl Gene ENSMUSG00000045962
Gene NameWNK lysine deficient protein kinase 1
Synonyms6430573H23Rik, Hsn2, EG406236, Prkwnk1
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1959 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location119923969-120038672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119969247 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 648 (I648M)
Ref Sequence ENSEMBL: ENSMUSP00000145304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060043] [ENSMUST00000088644] [ENSMUST00000088646] [ENSMUST00000177761] [ENSMUST00000203030]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035513
Predicted Effect probably damaging
Transcript: ENSMUST00000060043
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063001
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.5e-44 PFAM
Pfam:Pkinase 221 479 4.4e-58 PFAM
Pfam:OSR1_C 500 537 2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 865 876 N/A INTRINSIC
low complexity region 1018 1028 N/A INTRINSIC
low complexity region 1042 1058 N/A INTRINSIC
internal_repeat_1 1136 1178 2.15e-5 PROSPERO
low complexity region 1289 1305 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1398 1428 N/A INTRINSIC
low complexity region 1429 1454 N/A INTRINSIC
low complexity region 1496 1515 N/A INTRINSIC
low complexity region 1542 1556 N/A INTRINSIC
low complexity region 1586 1609 N/A INTRINSIC
low complexity region 1670 1691 N/A INTRINSIC
low complexity region 1698 1712 N/A INTRINSIC
low complexity region 1738 1764 N/A INTRINSIC
low complexity region 1882 1900 N/A INTRINSIC
coiled coil region 2065 2092 N/A INTRINSIC
low complexity region 2103 2114 N/A INTRINSIC
low complexity region 2116 2140 N/A INTRINSIC
low complexity region 2208 2232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088644
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086017
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 5.5e-44 PFAM
Pfam:Pkinase 221 479 4.3e-56 PFAM
Pfam:OSR1_C 500 537 1.9e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1146 1158 N/A INTRINSIC
low complexity region 1276 1286 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
internal_repeat_1 1394 1436 2.19e-5 PROSPERO
low complexity region 1547 1563 N/A INTRINSIC
low complexity region 1603 1615 N/A INTRINSIC
low complexity region 1637 1654 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
low complexity region 1687 1712 N/A INTRINSIC
low complexity region 1754 1773 N/A INTRINSIC
low complexity region 1800 1814 N/A INTRINSIC
low complexity region 1844 1867 N/A INTRINSIC
low complexity region 1928 1949 N/A INTRINSIC
low complexity region 1956 1970 N/A INTRINSIC
low complexity region 1996 2022 N/A INTRINSIC
low complexity region 2140 2158 N/A INTRINSIC
coiled coil region 2323 2350 N/A INTRINSIC
low complexity region 2361 2372 N/A INTRINSIC
low complexity region 2374 2398 N/A INTRINSIC
low complexity region 2466 2490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088646
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086019
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.3e-44 PFAM
Pfam:Pkinase 221 479 4e-58 PFAM
Pfam:OSR1_C 500 537 1.8e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 864 874 N/A INTRINSIC
low complexity region 888 904 N/A INTRINSIC
internal_repeat_1 982 1024 7.56e-6 PROSPERO
low complexity region 1135 1151 N/A INTRINSIC
low complexity region 1191 1203 N/A INTRINSIC
low complexity region 1225 1242 N/A INTRINSIC
low complexity region 1244 1274 N/A INTRINSIC
low complexity region 1275 1300 N/A INTRINSIC
low complexity region 1342 1361 N/A INTRINSIC
low complexity region 1388 1402 N/A INTRINSIC
low complexity region 1432 1455 N/A INTRINSIC
low complexity region 1516 1537 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1584 1610 N/A INTRINSIC
low complexity region 1700 1718 N/A INTRINSIC
coiled coil region 1883 1910 N/A INTRINSIC
low complexity region 1921 1932 N/A INTRINSIC
low complexity region 1934 1958 N/A INTRINSIC
low complexity region 2026 2050 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160769
Predicted Effect unknown
Transcript: ENSMUST00000161048
AA Change: I236M
SMART Domains Protein: ENSMUSP00000125345
Gene: ENSMUSG00000045962
AA Change: I236M

DomainStartEndE-ValueType
Blast:S_TKc 2 68 3e-34 BLAST
SCOP:d1phk__ 3 70 2e-7 SMART
Pfam:OSR1_C 89 126 9.5e-21 PFAM
coiled coil region 151 185 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161392
Predicted Effect probably benign
Transcript: ENSMUST00000162368
SMART Domains Protein: ENSMUSP00000125383
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177761
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136777
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.7e-44 PFAM
Pfam:Pkinase 221 479 5.1e-58 PFAM
Pfam:OSR1_C 500 537 2.2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
low complexity region 828 839 N/A INTRINSIC
low complexity region 1005 1021 N/A INTRINSIC
low complexity region 1136 1149 N/A INTRINSIC
low complexity region 1153 1162 N/A INTRINSIC
low complexity region 1232 1244 N/A INTRINSIC
low complexity region 1291 1307 N/A INTRINSIC
internal_repeat_1 1385 1427 1.91e-5 PROSPERO
low complexity region 1538 1554 N/A INTRINSIC
low complexity region 1594 1606 N/A INTRINSIC
low complexity region 1628 1645 N/A INTRINSIC
low complexity region 1647 1677 N/A INTRINSIC
low complexity region 1678 1703 N/A INTRINSIC
low complexity region 1745 1764 N/A INTRINSIC
low complexity region 1791 1805 N/A INTRINSIC
low complexity region 1835 1858 N/A INTRINSIC
low complexity region 1919 1940 N/A INTRINSIC
low complexity region 1947 1961 N/A INTRINSIC
low complexity region 1987 2013 N/A INTRINSIC
low complexity region 2131 2149 N/A INTRINSIC
coiled coil region 2314 2341 N/A INTRINSIC
low complexity region 2352 2363 N/A INTRINSIC
low complexity region 2365 2389 N/A INTRINSIC
low complexity region 2457 2481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203030
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145304
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 4.1e-44 PFAM
Pfam:Pkinase 221 479 3.2e-56 PFAM
Pfam:OSR1_C 500 537 1.5e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 793 809 N/A INTRINSIC
internal_repeat_1 887 929 5.8e-6 PROSPERO
low complexity region 1040 1056 N/A INTRINSIC
low complexity region 1096 1108 N/A INTRINSIC
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1149 1179 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1247 1266 N/A INTRINSIC
low complexity region 1293 1307 N/A INTRINSIC
low complexity region 1337 1360 N/A INTRINSIC
low complexity region 1421 1442 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1489 1515 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
coiled coil region 1816 1843 N/A INTRINSIC
low complexity region 1854 1865 N/A INTRINSIC
low complexity region 1867 1891 N/A INTRINSIC
low complexity region 1959 1983 N/A INTRINSIC
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die before birth, whereas heterozygotes survive and exhibit decreased blood pressure. Mice homozygous for an allele that does not produce the kidney isoform exhibit a slight increase in systemic arterial diastolic blood pressure and reduced sensitivity to amiloride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Lama2 G T 10: 27,422,618 P161T probably damaging Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Sec16a A T 2: 26,430,132 H1431Q probably benign Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tanc2 T A 11: 105,910,295 H1112Q probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Traf7 C A 17: 24,513,281 G191C probably damaging Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp335 C T 2: 164,894,802 G971D probably damaging Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Wnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Wnk1 APN 6 119960708 missense probably damaging 1.00
IGL01364:Wnk1 APN 6 119937411 missense probably damaging 1.00
IGL01715:Wnk1 APN 6 119948397 missense probably damaging 1.00
IGL01951:Wnk1 APN 6 119963485 missense probably damaging 0.99
IGL02043:Wnk1 APN 6 119949078 unclassified probably benign
IGL02268:Wnk1 APN 6 119937373 nonsense probably null
IGL02348:Wnk1 APN 6 119963328 missense probably damaging 0.98
IGL02425:Wnk1 APN 6 119963454 missense probably damaging 1.00
IGL02850:Wnk1 APN 6 119937862 missense probably benign 0.26
IGL03160:Wnk1 APN 6 119926633 missense probably damaging 1.00
IGL03387:Wnk1 APN 6 119954187 missense possibly damaging 0.76
IGL03405:Wnk1 APN 6 119953895 missense probably benign 0.41
Narrow UTSW 6 119992408 missense probably damaging 1.00
nictitate UTSW 6 120002280 missense possibly damaging 0.88
opportunity UTSW 6 119951068 missense probably damaging 1.00
path UTSW 6 120037149 missense probably damaging 0.99
Unforgiving UTSW 6 119948282 missense probably damaging 1.00
Window UTSW 6 119992453 missense probably damaging 1.00
woke UTSW 6 119962955 missense probably benign 0.12
IGL03052:Wnk1 UTSW 6 119944799 splice site probably benign
PIT4480001:Wnk1 UTSW 6 119963367 nonsense probably null
R0044:Wnk1 UTSW 6 120037149 missense probably damaging 0.99
R0207:Wnk1 UTSW 6 119952733 missense probably damaging 1.00
R0333:Wnk1 UTSW 6 119928163 intron probably benign
R0453:Wnk1 UTSW 6 119963151 missense probably damaging 0.99
R0457:Wnk1 UTSW 6 119969332 missense probably damaging 1.00
R0501:Wnk1 UTSW 6 119962803 missense probably damaging 1.00
R0525:Wnk1 UTSW 6 119926564 missense probably damaging 1.00
R0526:Wnk1 UTSW 6 119951992 missense probably damaging 0.99
R0606:Wnk1 UTSW 6 119926683 missense probably damaging 1.00
R0658:Wnk1 UTSW 6 119948505 missense probably damaging 0.98
R1148:Wnk1 UTSW 6 119952006 splice site probably benign
R1188:Wnk1 UTSW 6 119948709 nonsense probably null
R1245:Wnk1 UTSW 6 119948457 missense probably benign 0.26
R1449:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R1469:Wnk1 UTSW 6 119950684 splice site probably benign
R1869:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1871:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1928:Wnk1 UTSW 6 119952923 missense probably damaging 1.00
R1961:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1964:Wnk1 UTSW 6 119934382 missense possibly damaging 0.86
R1983:Wnk1 UTSW 6 119937578 missense probably damaging 1.00
R2062:Wnk1 UTSW 6 119928157 splice site probably null
R2144:Wnk1 UTSW 6 119948988 unclassified probably benign
R2186:Wnk1 UTSW 6 119948567 missense probably benign 0.26
R2281:Wnk1 UTSW 6 119963640 splice site probably null
R2338:Wnk1 UTSW 6 119969534 missense probably benign 0.42
R2420:Wnk1 UTSW 6 119936367 critical splice donor site probably null
R3727:Wnk1 UTSW 6 119992453 missense probably damaging 1.00
R3773:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R3836:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3837:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3847:Wnk1 UTSW 6 119969354 missense possibly damaging 0.70
R3903:Wnk1 UTSW 6 119949051 missense probably damaging 1.00
R4031:Wnk1 UTSW 6 119951068 missense probably damaging 1.00
R4095:Wnk1 UTSW 6 119948126 missense probably damaging 1.00
R4232:Wnk1 UTSW 6 119949261 missense possibly damaging 0.90
R4422:Wnk1 UTSW 6 119953895 missense probably benign 0.41
R4423:Wnk1 UTSW 6 119926426 missense probably damaging 1.00
R4572:Wnk1 UTSW 6 119951911 missense possibly damaging 0.49
R4704:Wnk1 UTSW 6 119965744 missense possibly damaging 0.83
R4755:Wnk1 UTSW 6 119963470 missense probably damaging 0.98
R4812:Wnk1 UTSW 6 119952771 missense probably benign 0.16
R4822:Wnk1 UTSW 6 119962438 missense probably benign 0.02
R4879:Wnk1 UTSW 6 119949377 missense probably damaging 1.00
R4970:Wnk1 UTSW 6 119965735 intron probably benign
R5002:Wnk1 UTSW 6 119937963 missense probably benign 0.13
R5037:Wnk1 UTSW 6 119965735 intron probably benign
R5152:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R5257:Wnk1 UTSW 6 120037188 missense probably benign 0.00
R5354:Wnk1 UTSW 6 119968523 missense probably benign 0.01
R5421:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R5564:Wnk1 UTSW 6 119948891 unclassified probably benign
R5600:Wnk1 UTSW 6 119949358 missense probably damaging 1.00
R5847:Wnk1 UTSW 6 119992408 missense probably damaging 1.00
R6083:Wnk1 UTSW 6 120037601 missense probably damaging 0.99
R6110:Wnk1 UTSW 6 119972997 intron probably benign
R6128:Wnk1 UTSW 6 119963786 unclassified probably null
R6237:Wnk1 UTSW 6 119952767 missense probably damaging 1.00
R6341:Wnk1 UTSW 6 119948585 missense probably damaging 1.00
R6467:Wnk1 UTSW 6 119962955 missense probably benign 0.12
R6696:Wnk1 UTSW 6 119948282 missense probably damaging 1.00
R6888:Wnk1 UTSW 6 119948781 missense probably benign 0.26
R6923:Wnk1 UTSW 6 119965678 intron probably benign
R7024:Wnk1 UTSW 6 119965726 intron probably benign
R7072:Wnk1 UTSW 6 119937861 missense unknown
R7087:Wnk1 UTSW 6 120037530 missense possibly damaging 0.94
R7102:Wnk1 UTSW 6 119948307 missense unknown
R7134:Wnk1 UTSW 6 119926428 missense unknown
R7137:Wnk1 UTSW 6 120038212 unclassified probably benign
R7142:Wnk1 UTSW 6 119949279 missense probably benign 0.09
R7174:Wnk1 UTSW 6 119970978 missense probably damaging 1.00
R7218:Wnk1 UTSW 6 120002273 nonsense probably null
X0064:Wnk1 UTSW 6 120037032 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCTGTGGAGACCTATGTGTAC -3'
(R):5'- AGCAGTTTCAAACAGCAGAATG -3'

Sequencing Primer
(F):5'- AGCACTGGTCTTATCAATTTTTGGTC -3'
(R):5'- TGAACAACAAGCAAGCGTTTC -3'
Posted On2014-08-01