Incidental Mutation 'R1959:Lama2'
ID218175
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 039973-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R1959 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27422618 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 161 (P161T)
Ref Sequence ENSEMBL: ENSMUSP00000140716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
Predicted Effect probably damaging
Transcript: ENSMUST00000092639
AA Change: P161T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: P161T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188963
Predicted Effect probably damaging
Transcript: ENSMUST00000189575
AA Change: P161T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: P161T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Aco1 T C 4: 40,167,193 probably null Het
Adap1 A G 5: 139,273,341 Y364H probably benign Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgb A T 10: 10,395,249 D883E probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Anapc1 C A 2: 128,633,415 R1381S probably benign Het
Aoah A G 13: 20,794,394 M1V probably null Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arhgap10 A G 8: 77,409,626 F319S possibly damaging Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cabin1 A T 10: 75,735,090 V784E possibly damaging Het
Card9 T A 2: 26,354,873 probably null Het
Cdk18 A G 1: 132,117,821 I238T possibly damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Commd3 A T 2: 18,673,963 I70F probably benign Het
Cspg5 G A 9: 110,251,026 V340M probably damaging Het
Cyb5r4 G A 9: 87,055,849 S307N possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Ddx11 A G 17: 66,130,728 M150V probably benign Het
Dennd4b A G 3: 90,268,773 Y190C probably damaging Het
Det1 A G 7: 78,843,443 V271A probably benign Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dhx36 T C 3: 62,479,385 S649G probably benign Het
Dlgap5 A G 14: 47,416,386 I62T possibly damaging Het
Dmgdh A G 13: 93,720,559 M724V probably benign Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dock4 A T 12: 40,710,798 K495M probably damaging Het
Dse A G 10: 34,160,206 Y225H probably damaging Het
Emx1 G A 6: 85,203,934 R211K probably damaging Het
Ergic2 A G 6: 148,199,354 probably null Het
Fbxo27 G A 7: 28,698,372 C277Y possibly damaging Het
Fcrl1 T C 3: 87,376,520 I9T possibly damaging Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Flnb C T 14: 7,884,735 Q445* probably null Het
Flrt2 G A 12: 95,780,300 V471I probably benign Het
Frmd4a G A 2: 4,535,186 V210M probably damaging Het
Fsip2 A G 2: 82,991,550 K5876E probably benign Het
Galnt10 T C 11: 57,765,617 L209P probably damaging Het
Gata5 A T 2: 180,326,936 S382T possibly damaging Het
Glt6d1 C A 2: 25,794,413 V194L probably damaging Het
Gm10803 T G 2: 93,563,943 V20G unknown Het
Gm44511 T G 6: 128,820,271 T52P probably damaging Het
Gpat4 A T 8: 23,182,936 L88Q possibly damaging Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Hivep2 A T 10: 14,132,709 I1684F probably benign Het
Hmcn1 T C 1: 150,649,676 T3366A probably benign Het
Hnmt A G 2: 24,003,882 V200A possibly damaging Het
Hps6 A T 19: 46,004,335 H237L probably benign Het
Hspg2 C T 4: 137,564,895 P4033S probably damaging Het
Irf9 T A 14: 55,607,717 S297T possibly damaging Het
Kdm3b T C 18: 34,812,395 V753A possibly damaging Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Krtap4-16 A G 11: 99,851,547 V9A unknown Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Lvrn T A 18: 46,894,717 S866R probably damaging Het
Med13 A G 11: 86,298,979 Y1035H probably damaging Het
Mertk T A 2: 128,759,090 N331K probably damaging Het
Mios T A 6: 8,215,437 F211Y probably benign Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mphosph9 A T 5: 124,315,701 S183T possibly damaging Het
Mrto4 A T 4: 139,349,638 I56N probably damaging Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Ncoa2 A G 1: 13,160,252 Y1023H probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Nr2f1 T C 13: 78,189,816 T237A probably damaging Het
Nup205 C A 6: 35,233,366 Q1621K probably benign Het
Nxpe2 T A 9: 48,319,726 S448C probably benign Het
Ogdh T A 11: 6,346,638 C498S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr281 T C 15: 98,456,753 S148P probably damaging Het
Olfr294 A T 7: 86,616,431 F71L probably benign Het
Olfr414 A T 1: 174,430,905 K159M probably damaging Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr715 A T 7: 107,128,510 D294E possibly damaging Het
Olfr994 T C 2: 85,430,619 D70G probably damaging Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pcdhb9 T A 18: 37,403,316 Y788N probably damaging Het
Pcsk5 T C 19: 17,433,418 D1870G unknown Het
Pde6g A G 11: 120,448,136 L76P probably damaging Het
Peak1 A T 9: 56,206,789 Y593N probably damaging Het
Pfas C T 11: 68,994,284 G16R probably damaging Het
Pkd1l2 A T 8: 117,043,231 probably null Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Ptpru T A 4: 131,803,477 I489F probably damaging Het
Rere T G 4: 150,468,790 H146Q probably benign Het
Rundc1 A T 11: 101,431,496 Q272L probably damaging Het
Scml4 T C 10: 42,956,021 L305P probably damaging Het
Sec16a A T 2: 26,430,132 H1431Q probably benign Het
Serpina1a G A 12: 103,853,800 Q373* probably null Het
Shank1 A T 7: 44,325,377 N377I unknown Het
Shc2 T C 10: 79,626,791 probably null Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc7a2 A T 8: 40,914,965 I589F probably damaging Het
Smim8 C T 4: 34,771,316 R26Q probably damaging Het
Smox C A 2: 131,520,464 A221D probably damaging Het
Sox5 A G 6: 143,874,105 S62P possibly damaging Het
Spg21 A C 9: 65,484,492 K240N probably damaging Het
Sv2c C T 13: 95,976,645 V599M probably damaging Het
Tanc2 T A 11: 105,910,295 H1112Q probably damaging Het
Tbata T C 10: 61,175,844 I58T possibly damaging Het
Tbc1d2 T G 4: 46,606,419 Y842S probably benign Het
Tctn1 A T 5: 122,241,840 probably null Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Tfcp2l1 T C 1: 118,669,389 V400A probably benign Het
Tm9sf2 T A 14: 122,126,164 L99I probably benign Het
Top2a T C 11: 98,995,977 probably null Het
Traf7 C A 17: 24,513,281 G191C probably damaging Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttc30b C T 2: 75,937,099 E437K probably benign Het
Ttn T C 2: 76,750,623 I23309V probably benign Het
Usp50 T C 2: 126,777,961 K199E possibly damaging Het
Vmn1r218 T C 13: 23,136,513 F10S probably damaging Het
Vmn2r89 C A 14: 51,457,440 T459K probably benign Het
Vps13a T G 19: 16,677,938 S1909R possibly damaging Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Vwa8 A G 14: 78,982,360 H516R possibly damaging Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Zfat G C 15: 68,146,543 P974R probably benign Het
Zfc3h1 T A 10: 115,423,253 I1601K probably benign Het
Zfp239 A G 6: 117,871,817 K172R probably benign Het
Zfp335 C T 2: 164,894,802 G971D probably damaging Het
Zfp532 A T 18: 65,624,492 I499F probably damaging Het
Zfp647 T C 15: 76,911,114 T449A possibly damaging Het
Zfp938 C T 10: 82,225,631 G385D probably damaging Het
Zfp959 T G 17: 55,897,404 V147G probably damaging Het
Znfx1 A T 2: 167,050,350 C649S probably damaging Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCACTGACGTTAGTTACTGACAC -3'
(R):5'- AGCCGTCTTTCTATTTGGAATGAC -3'

Sequencing Primer
(F):5'- GCTATTTTACAGTACTCAATGCAGC -3'
(R):5'- CTATTTGGAATGACTGAGAGAGTGC -3'
Posted On2014-08-01