Incidental Mutation 'R0134:Bicd1'
ID21819
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene NameBICD cargo adaptor 1
SynonymsB830009D06Rik
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0134 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location149408886-149563329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149512950 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 387 (I387T)
Ref Sequence ENSEMBL: ENSMUSP00000133727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]
Predicted Effect probably benign
Transcript: ENSMUST00000003544
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086829
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111513
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172926
SMART Domains Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452

DomainStartEndE-ValueType
Pfam:BicD 1 98 1.2e-69 PFAM
low complexity region 103 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173408
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174886
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Hps1 G T 19: 42,766,180 Q277K probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0131:Bicd1 UTSW 6 149512947 missense probably damaging 0.99
R0225:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149511962 missense probably benign 0.34
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5527:Bicd1 UTSW 6 149494636 missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
R7362:Bicd1 UTSW 6 149484093 missense probably benign 0.13
R7526:Bicd1 UTSW 6 149513726 missense not run
R7545:Bicd1 UTSW 6 149513492 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCTTTTCCCTGAAGTGATTCAGAC -3'
(R):5'- GGCTATGCCAGTCATCTTTTGCAAC -3'

Sequencing Primer
(F):5'- ATTCAGACATTGTCTTCTGTCATTAC -3'
(R):5'- GATGTCTTCTCAAGGTTTGTCAC -3'
Posted On2013-04-12