Incidental Mutation 'R0725:Cyp4b1'
ID218369
Institutional Source Beutler Lab
Gene Symbol Cyp4b1
Ensembl Gene ENSMUSG00000028713
Gene Namecytochrome P450, family 4, subfamily b, polypeptide 1
Synonyms
MMRRC Submission 038907-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0725 (G1)
Quality Score58
Status Validated
Chromosome4
Chromosomal Location115624725-115647723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115626827 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 395 (D395G)
Ref Sequence ENSEMBL: ENSMUSP00000099768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102707]
Predicted Effect probably damaging
Transcript: ENSMUST00000102707
AA Change: D395G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099768
Gene: ENSMUSG00000028713
AA Change: D395G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 46 501 1.3e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143237
Predicted Effect unknown
Transcript: ENSMUST00000145841
AA Change: D319G
SMART Domains Protein: ENSMUSP00000118323
Gene: ENSMUSG00000028713
AA Change: D319G

DomainStartEndE-ValueType
Pfam:p450 1 375 3.5e-101 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to 4-ipomeanol activation and toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,027,143 D131E probably damaging Het
Asph C T 4: 9,542,275 D305N probably damaging Het
Atp13a3 T C 16: 30,351,387 K327R probably damaging Het
Cacna1s T C 1: 136,098,526 probably benign Het
Ccnk T C 12: 108,195,575 probably benign Het
Cep55 T C 19: 38,060,174 S93P possibly damaging Het
Cfh A G 1: 140,157,343 probably benign Het
Clptm1l A G 13: 73,606,343 T129A probably benign Het
Cntnap5a A G 1: 116,292,476 E672G probably benign Het
Cpped1 C A 16: 11,828,450 W170L probably damaging Het
Crygb T C 1: 65,081,941 I76V probably benign Het
Cyp3a25 A G 5: 145,994,936 S121P probably damaging Het
Dll4 T C 2: 119,332,689 V597A probably damaging Het
Dock7 T C 4: 98,945,291 D1891G probably damaging Het
Dsel T C 1: 111,859,952 D951G possibly damaging Het
Dync2h1 C A 9: 7,015,497 V3603F possibly damaging Het
Fam109a T A 5: 121,853,251 H225Q probably benign Het
Fam129a A G 1: 151,706,015 E454G probably benign Het
Fam167b C A 4: 129,578,285 A31S probably damaging Het
Fgfrl1 T A 5: 108,704,673 I25N probably damaging Het
Gzf1 C T 2: 148,684,649 R347* probably null Het
Heatr5b T A 17: 78,796,396 I1117F probably benign Het
Kntc1 T C 5: 123,769,704 V456A possibly damaging Het
Macc1 C A 12: 119,447,516 S673* probably null Het
Mpp4 T C 1: 59,121,422 E574G probably damaging Het
Muc20 C T 16: 32,793,488 M506I probably benign Het
Ncbp1 A G 4: 46,152,056 T218A probably benign Het
Nfxl1 A T 5: 72,559,130 V46E probably benign Het
Nfyc G T 4: 120,768,734 probably benign Het
Olfr561 T A 7: 102,774,532 S3T probably benign Het
Olfr972 A T 9: 39,873,347 Q24L probably damaging Het
Osbpl8 T C 10: 111,286,240 F681S possibly damaging Het
Pcm1 G C 8: 41,287,811 E1031D probably damaging Het
Pdcd11 A G 19: 47,127,291 E1486G probably benign Het
Pex12 G T 11: 83,298,034 A45E probably damaging Het
Pigm A G 1: 172,376,817 D40G probably damaging Het
Pkp1 G T 1: 135,880,740 N496K probably benign Het
Psmc4 T C 7: 28,048,862 I54V probably benign Het
Rbm33 T C 5: 28,394,483 V951A unknown Het
Selenbp2 G T 3: 94,697,502 probably benign Het
Slc3a1 G A 17: 85,060,835 W510* probably null Het
Stx12 A C 4: 132,857,390 probably benign Het
Tas2r125 G T 6: 132,910,122 D158Y probably benign Het
Tchp C A 5: 114,719,621 Q392K probably benign Het
Tmed11 T A 5: 108,778,989 D139V probably damaging Het
Ttn C T 2: 76,748,310 V24080M probably damaging Het
Ush2a G A 1: 188,951,525 G4967D probably damaging Het
Vezf1 T C 11: 88,073,330 S103P probably benign Het
Xpnpep3 T C 15: 81,430,842 S248P probably damaging Het
Yipf2 G C 9: 21,592,223 probably null Het
Zfp110 A T 7: 12,836,363 Q39L possibly damaging Het
Zfp287 A T 11: 62,714,213 C623S probably damaging Het
Other mutations in Cyp4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Cyp4b1 APN 4 115636282 missense probably damaging 0.97
IGL02484:Cyp4b1 APN 4 115647557 missense probably benign 0.00
IGL03111:Cyp4b1 APN 4 115635869 splice site probably benign
IGL03340:Cyp4b1 APN 4 115641879 missense probably damaging 1.00
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0143:Cyp4b1 UTSW 4 115635874 missense probably damaging 0.99
R0532:Cyp4b1 UTSW 4 115626876 missense probably damaging 1.00
R0970:Cyp4b1 UTSW 4 115635636 missense probably benign 0.07
R1084:Cyp4b1 UTSW 4 115640312 missense probably benign 0.00
R1570:Cyp4b1 UTSW 4 115635963 missense probably benign 0.00
R1626:Cyp4b1 UTSW 4 115641658 missense probably damaging 1.00
R1966:Cyp4b1 UTSW 4 115625879 missense probably benign 0.13
R2279:Cyp4b1 UTSW 4 115640360 missense probably benign 0.23
R2396:Cyp4b1 UTSW 4 115641646 missense probably benign 0.43
R2679:Cyp4b1 UTSW 4 115628697 missense probably benign 0.01
R2885:Cyp4b1 UTSW 4 115635652 missense probably damaging 1.00
R3176:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R3276:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R4375:Cyp4b1 UTSW 4 115636313 missense probably benign 0.35
R7221:Cyp4b1 UTSW 4 115635978 missense possibly damaging 0.92
X0058:Cyp4b1 UTSW 4 115628778 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACACTGTGAGCCTGGTGCTTGG -3'
(R):5'- TGGAGCCTCTATGACTCCTCTGTTG -3'

Sequencing Primer
(F):5'- AGCGTCCAGAGGACTTTCAT -3'
(R):5'- CTATGACTCCTCTGTTGGAAGTATG -3'
Posted On2014-08-01