Incidental Mutation 'R0725:Vezf1'
ID218381
Institutional Source Beutler Lab
Gene Symbol Vezf1
Ensembl Gene ENSMUSG00000018377
Gene Namevascular endothelial zinc finger 1
Synonymsdb1
MMRRC Submission 038907-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0725 (G1)
Quality Score25
Status Validated
Chromosome11
Chromosomal Location88068279-88084729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88073330 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 103 (S103P)
Ref Sequence ENSEMBL: ENSMUSP00000018521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018521] [ENSMUST00000143052]
Predicted Effect probably benign
Transcript: ENSMUST00000018521
AA Change: S103P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018521
Gene: ENSMUSG00000018377
AA Change: S103P

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
ZnF_C2H2 74 96 3.83e-2 SMART
low complexity region 137 172 N/A INTRINSIC
ZnF_C2H2 174 196 6.78e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 232 255 1.1e-2 SMART
ZnF_C2H2 261 283 3.16e-3 SMART
ZnF_C2H2 287 308 2.61e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143052
SMART Domains Protein: ENSMUSP00000114394
Gene: ENSMUSG00000018377

DomainStartEndE-ValueType
ZnF_C2H2 14 36 2.99e-4 SMART
ZnF_C2H2 44 67 1.1e-2 SMART
ZnF_C2H2 73 101 2.47e1 SMART
ZnF_C2H2 105 126 2.61e1 SMART
low complexity region 153 169 N/A INTRINSIC
low complexity region 186 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]
PHENOTYPE: Homozygous null mice die at midgestation due to angiogenic remodeling defects and loss of vascular integrity leading to hemorrhaging in the head, heart and trunk. One fifth of heterozygous null embryos show lymphatic hypervascularization associated with hemorrhaging and edema in the jugular region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,027,143 D131E probably damaging Het
Asph C T 4: 9,542,275 D305N probably damaging Het
Atp13a3 T C 16: 30,351,387 K327R probably damaging Het
Cacna1s T C 1: 136,098,526 probably benign Het
Ccnk T C 12: 108,195,575 probably benign Het
Cep55 T C 19: 38,060,174 S93P possibly damaging Het
Cfh A G 1: 140,157,343 probably benign Het
Clptm1l A G 13: 73,606,343 T129A probably benign Het
Cntnap5a A G 1: 116,292,476 E672G probably benign Het
Cpped1 C A 16: 11,828,450 W170L probably damaging Het
Crygb T C 1: 65,081,941 I76V probably benign Het
Cyp3a25 A G 5: 145,994,936 S121P probably damaging Het
Cyp4b1 T C 4: 115,626,827 D395G probably damaging Het
Dll4 T C 2: 119,332,689 V597A probably damaging Het
Dock7 T C 4: 98,945,291 D1891G probably damaging Het
Dsel T C 1: 111,859,952 D951G possibly damaging Het
Dync2h1 C A 9: 7,015,497 V3603F possibly damaging Het
Fam109a T A 5: 121,853,251 H225Q probably benign Het
Fam129a A G 1: 151,706,015 E454G probably benign Het
Fam167b C A 4: 129,578,285 A31S probably damaging Het
Fgfrl1 T A 5: 108,704,673 I25N probably damaging Het
Gzf1 C T 2: 148,684,649 R347* probably null Het
Heatr5b T A 17: 78,796,396 I1117F probably benign Het
Kntc1 T C 5: 123,769,704 V456A possibly damaging Het
Macc1 C A 12: 119,447,516 S673* probably null Het
Mpp4 T C 1: 59,121,422 E574G probably damaging Het
Muc20 C T 16: 32,793,488 M506I probably benign Het
Ncbp1 A G 4: 46,152,056 T218A probably benign Het
Nfxl1 A T 5: 72,559,130 V46E probably benign Het
Nfyc G T 4: 120,768,734 probably benign Het
Olfr561 T A 7: 102,774,532 S3T probably benign Het
Olfr972 A T 9: 39,873,347 Q24L probably damaging Het
Osbpl8 T C 10: 111,286,240 F681S possibly damaging Het
Pcm1 G C 8: 41,287,811 E1031D probably damaging Het
Pdcd11 A G 19: 47,127,291 E1486G probably benign Het
Pex12 G T 11: 83,298,034 A45E probably damaging Het
Pigm A G 1: 172,376,817 D40G probably damaging Het
Pkp1 G T 1: 135,880,740 N496K probably benign Het
Psmc4 T C 7: 28,048,862 I54V probably benign Het
Rbm33 T C 5: 28,394,483 V951A unknown Het
Selenbp2 G T 3: 94,697,502 probably benign Het
Slc3a1 G A 17: 85,060,835 W510* probably null Het
Stx12 A C 4: 132,857,390 probably benign Het
Tas2r125 G T 6: 132,910,122 D158Y probably benign Het
Tchp C A 5: 114,719,621 Q392K probably benign Het
Tmed11 T A 5: 108,778,989 D139V probably damaging Het
Ttn C T 2: 76,748,310 V24080M probably damaging Het
Ush2a G A 1: 188,951,525 G4967D probably damaging Het
Xpnpep3 T C 15: 81,430,842 S248P probably damaging Het
Yipf2 G C 9: 21,592,223 probably null Het
Zfp110 A T 7: 12,836,363 Q39L possibly damaging Het
Zfp287 A T 11: 62,714,213 C623S probably damaging Het
Other mutations in Vezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Vezf1 APN 11 88073494 missense probably benign 0.14
IGL00576:Vezf1 APN 11 88073644 nonsense probably null
IGL02683:Vezf1 APN 11 88076327 missense probably benign 0.36
IGL02700:Vezf1 APN 11 88073303 missense probably damaging 0.97
IGL02701:Vezf1 APN 11 88076221 nonsense probably null
R0541:Vezf1 UTSW 11 88081577 missense possibly damaging 0.77
R0591:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0592:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0758:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0803:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0853:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0854:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R1491:Vezf1 UTSW 11 88073747 missense probably damaging 1.00
R1605:Vezf1 UTSW 11 88076299 missense possibly damaging 0.75
R1781:Vezf1 UTSW 11 88081621 missense probably benign 0.28
R3898:Vezf1 UTSW 11 88076173 missense probably benign
R4656:Vezf1 UTSW 11 88074667 missense probably damaging 1.00
R4868:Vezf1 UTSW 11 88074694 missense probably damaging 1.00
R5946:Vezf1 UTSW 11 88073734 nonsense probably null
R6190:Vezf1 UTSW 11 88076186 missense probably benign 0.02
R6258:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6260:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6452:Vezf1 UTSW 11 88081670 missense possibly damaging 0.66
R6680:Vezf1 UTSW 11 88081584 missense probably benign 0.23
R6983:Vezf1 UTSW 11 88073319 missense possibly damaging 0.88
R7086:Vezf1 UTSW 11 88078538 missense probably benign 0.00
R7322:Vezf1 UTSW 11 88081584 missense possibly damaging 0.68
R7443:Vezf1 UTSW 11 88074663 missense probably damaging 1.00
X0019:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
X0067:Vezf1 UTSW 11 88081728 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ATTACTCAGAAACCTCAGGCTGCAC -3'
(R):5'- CACATGGTAAGTCATCCGGTCCTTC -3'

Sequencing Primer
(F):5'- CCAGAAACATTAAAGGATGCCATTG -3'
(R):5'- ATTGAGGTGGTACACATCCC -3'
Posted On2014-08-01