Incidental Mutation 'R0725:Heatr5b'
ID218387
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission 038907-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R0725 (G1)
Quality Score64
Status Validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78796396 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1117 (I1117F)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: I1117F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: I1117F

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.7%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,027,143 D131E probably damaging Het
Asph C T 4: 9,542,275 D305N probably damaging Het
Atp13a3 T C 16: 30,351,387 K327R probably damaging Het
Cacna1s T C 1: 136,098,526 probably benign Het
Ccnk T C 12: 108,195,575 probably benign Het
Cep55 T C 19: 38,060,174 S93P possibly damaging Het
Cfh A G 1: 140,157,343 probably benign Het
Clptm1l A G 13: 73,606,343 T129A probably benign Het
Cntnap5a A G 1: 116,292,476 E672G probably benign Het
Cpped1 C A 16: 11,828,450 W170L probably damaging Het
Crygb T C 1: 65,081,941 I76V probably benign Het
Cyp3a25 A G 5: 145,994,936 S121P probably damaging Het
Cyp4b1 T C 4: 115,626,827 D395G probably damaging Het
Dll4 T C 2: 119,332,689 V597A probably damaging Het
Dock7 T C 4: 98,945,291 D1891G probably damaging Het
Dsel T C 1: 111,859,952 D951G possibly damaging Het
Dync2h1 C A 9: 7,015,497 V3603F possibly damaging Het
Fam109a T A 5: 121,853,251 H225Q probably benign Het
Fam129a A G 1: 151,706,015 E454G probably benign Het
Fam167b C A 4: 129,578,285 A31S probably damaging Het
Fgfrl1 T A 5: 108,704,673 I25N probably damaging Het
Gzf1 C T 2: 148,684,649 R347* probably null Het
Kntc1 T C 5: 123,769,704 V456A possibly damaging Het
Macc1 C A 12: 119,447,516 S673* probably null Het
Mpp4 T C 1: 59,121,422 E574G probably damaging Het
Muc20 C T 16: 32,793,488 M506I probably benign Het
Ncbp1 A G 4: 46,152,056 T218A probably benign Het
Nfxl1 A T 5: 72,559,130 V46E probably benign Het
Nfyc G T 4: 120,768,734 probably benign Het
Olfr561 T A 7: 102,774,532 S3T probably benign Het
Olfr972 A T 9: 39,873,347 Q24L probably damaging Het
Osbpl8 T C 10: 111,286,240 F681S possibly damaging Het
Pcm1 G C 8: 41,287,811 E1031D probably damaging Het
Pdcd11 A G 19: 47,127,291 E1486G probably benign Het
Pex12 G T 11: 83,298,034 A45E probably damaging Het
Pigm A G 1: 172,376,817 D40G probably damaging Het
Pkp1 G T 1: 135,880,740 N496K probably benign Het
Psmc4 T C 7: 28,048,862 I54V probably benign Het
Rbm33 T C 5: 28,394,483 V951A unknown Het
Selenbp2 G T 3: 94,697,502 probably benign Het
Slc3a1 G A 17: 85,060,835 W510* probably null Het
Stx12 A C 4: 132,857,390 probably benign Het
Tas2r125 G T 6: 132,910,122 D158Y probably benign Het
Tchp C A 5: 114,719,621 Q392K probably benign Het
Tmed11 T A 5: 108,778,989 D139V probably damaging Het
Ttn C T 2: 76,748,310 V24080M probably damaging Het
Ush2a G A 1: 188,951,525 G4967D probably damaging Het
Vezf1 T C 11: 88,073,330 S103P probably benign Het
Xpnpep3 T C 15: 81,430,842 S248P probably damaging Het
Yipf2 G C 9: 21,592,223 probably null Het
Zfp110 A T 7: 12,836,363 Q39L possibly damaging Het
Zfp287 A T 11: 62,714,213 C623S probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCAGAGTTTCCGGTCTGTCTCTC -3'
(R):5'- GCTGTAGTCACTGTCCTGACTTGTG -3'

Sequencing Primer
(F):5'- GTCACTGCGAGAGCTAACTC -3'
(R):5'- CTTGTGATGTGACAGGTTCACC -3'
Posted On2014-08-01