Incidental Mutation 'R0045:Atg9b'
ID218395
Institutional Source Beutler Lab
Gene Symbol Atg9b
Ensembl Gene ENSMUSG00000038295
Gene Nameautophagy related 9B
SynonymsLOC213948, Apg9l2, Nos3as, eONE
MMRRC Submission 038339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R0045 (G1)
Quality Score71
Status Validated
Chromosome5
Chromosomal Location24384181-24392143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24387398 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 621 (Q621K)
Ref Sequence ENSEMBL: ENSMUSP00000051864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000059401] [ENSMUST00000115090]
Predicted Effect probably benign
Transcript: ENSMUST00000030834
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059401
AA Change: Q621K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051864
Gene: ENSMUSG00000038295
AA Change: Q621K

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 279 296 N/A INTRINSIC
Pfam:APG9 321 681 1.2e-100 PFAM
low complexity region 782 799 N/A INTRINSIC
low complexity region 838 847 N/A INTRINSIC
low complexity region 854 871 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115090
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156403
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Atg9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Atg9b APN 5 24386515 unclassified probably null
IGL02020:Atg9b APN 5 24391058 missense possibly damaging 0.89
R1698:Atg9b UTSW 5 24388188 missense probably damaging 1.00
R1807:Atg9b UTSW 5 24387057 missense probably damaging 1.00
R1885:Atg9b UTSW 5 24388254 missense probably damaging 1.00
R2183:Atg9b UTSW 5 24390493 missense probably benign 0.01
R2224:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2226:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2227:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2426:Atg9b UTSW 5 24386994 missense probably damaging 1.00
R2919:Atg9b UTSW 5 24391544 missense possibly damaging 0.66
R3003:Atg9b UTSW 5 24391219 missense probably damaging 1.00
R4772:Atg9b UTSW 5 24385239 makesense probably null
R4786:Atg9b UTSW 5 24386089 missense possibly damaging 0.92
R5901:Atg9b UTSW 5 24392019 unclassified probably benign
R6410:Atg9b UTSW 5 24386110 missense possibly damaging 0.46
R6505:Atg9b UTSW 5 24390577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGGCTGCAATGGGGACCTAC -3'
(R):5'- CCCTTAGCAAACCTTAGCTGTCACC -3'

Sequencing Primer
(F):5'- CCTACAAGTGATCAGGGTCCAG -3'
(R):5'- AGCTGTCACCATCCGTGC -3'
Posted On2014-08-06