Incidental Mutation 'R0053:Cblb'
ID218418
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene NameCasitas B-lineage lymphoma b
SynonymsCbl-b
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R0053 (G1)
Quality Score32
Status Validated
Chromosome16
Chromosomal Location52031225-52208048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52142801 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 369 (T369I)
Ref Sequence ENSEMBL: ENSMUSP00000153787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114471
AA Change: T369I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: T369I

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226593
AA Change: T369I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227062
AA Change: T369I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000227756
AA Change: T217I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000227879
AA Change: T369I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
PIT4362001:Cblb UTSW 16 52139542 nonsense probably null
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1245:Cblb UTSW 16 52047187 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5318:Cblb UTSW 16 52186198 missense possibly damaging 0.88
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6152:Cblb UTSW 16 52141056 missense probably damaging 0.98
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R6914:Cblb UTSW 16 52047430 missense probably damaging 1.00
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTTCGTCCTCAGATTCCTAAAGATGC -3'
(R):5'- TCCTGAGTCAGTAAGATGTGGAAGGC -3'

Sequencing Primer
(F):5'- gaaaacaagaaaaaaagaaaagaCCG -3'
(R):5'- CTGAGAGGGGAAGTGTGAAC -3'
Posted On2014-08-06