Incidental Mutation 'R0021:Siah2'
ID218429
Institutional Source Beutler Lab
Gene Symbol Siah2
Ensembl Gene ENSMUSG00000036432
Gene Namesiah E3 ubiquitin protein ligase 2
SynonymsSinh2
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0021 (G1)
Quality Score75
Status Validated
Chromosome3
Chromosomal Location58674938-58692400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58676292 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 191 (H191R)
Ref Sequence ENSEMBL: ENSMUSP00000067496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070368]
Predicted Effect probably benign
Transcript: ENSMUST00000070368
AA Change: H191R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067496
Gene: ENSMUSG00000036432
AA Change: H191R

DomainStartEndE-ValueType
low complexity region 18 70 N/A INTRINSIC
RING 81 115 6.18e-1 SMART
Pfam:Sina 123 319 6.5e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145032
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in regulating cellular response to hypoxia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Nqo2 T C 13: 33,981,507 I129T probably benign Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Siah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Siah2 APN 3 58676047 missense probably damaging 1.00
R0021:Siah2 UTSW 3 58676292 missense probably benign 0.00
R0123:Siah2 UTSW 3 58676115 missense probably damaging 0.98
R0134:Siah2 UTSW 3 58676115 missense probably damaging 0.98
R0564:Siah2 UTSW 3 58676235 missense probably benign 0.32
R0648:Siah2 UTSW 3 58676214 missense probably damaging 0.99
R1164:Siah2 UTSW 3 58676316 missense probably benign 0.43
R1387:Siah2 UTSW 3 58691514 missense possibly damaging 0.95
R1955:Siah2 UTSW 3 58676097 missense probably damaging 0.99
R3732:Siah2 UTSW 3 58676250 missense probably damaging 1.00
R3732:Siah2 UTSW 3 58676250 missense probably damaging 1.00
R3733:Siah2 UTSW 3 58676250 missense probably damaging 1.00
R5704:Siah2 UTSW 3 58676400 missense probably damaging 1.00
R6738:Siah2 UTSW 3 58691553 missense probably benign 0.37
R6821:Siah2 UTSW 3 58691770 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGCCACGCCATCATGAATGGAC -3'
(R):5'- TGCATAGATGCTGGTACTGAGGAGG -3'

Sequencing Primer
(F):5'- TCTGTAGGCAAAGTTCTCAGC -3'
(R):5'- atgctggtactgAGGAGGTTTTG -3'
Posted On2014-08-08