Incidental Mutation 'R0021:Nqo2'
ID218439
Institutional Source Beutler Lab
Gene Symbol Nqo2
Ensembl Gene ENSMUSG00000046949
Gene NameN-ribosyldihydronicotinamide quinone reductase 2
SynonymsNmor2, Ox-2, NRH: quinone oxidoreductase, Ox2
MMRRC Submission 038316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R0021 (G1)
Quality Score71
Status Validated
Chromosome13
Chromosomal Location33964687-33988443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33981507 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 129 (I129T)
Ref Sequence ENSEMBL: ENSMUSP00000152598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021843] [ENSMUST00000058978] [ENSMUST00000076532] [ENSMUST00000166354] [ENSMUST00000167237] [ENSMUST00000168400] [ENSMUST00000171034] [ENSMUST00000220844] [ENSMUST00000222740] [ENSMUST00000223479]
Predicted Effect probably benign
Transcript: ENSMUST00000021843
AA Change: I129T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021843
Gene: ENSMUSG00000046949
AA Change: I129T

DomainStartEndE-ValueType
Pfam:FMN_red 4 159 5.6e-15 PFAM
Pfam:Flavodoxin_2 4 212 3.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058978
AA Change: I129T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053809
Gene: ENSMUSG00000046949
AA Change: I129T

DomainStartEndE-ValueType
Pfam:FMN_red 4 158 2e-14 PFAM
Pfam:Flavodoxin_2 4 212 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076532
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166354
SMART Domains Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 66 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167597
Predicted Effect probably benign
Transcript: ENSMUST00000168400
SMART Domains Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 120 3.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170620
Predicted Effect probably benign
Transcript: ENSMUST00000171034
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220844
AA Change: I85T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222740
AA Change: I129T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223479
AA Change: I129T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygouse for disruptions in this gene have an essentially normal phenotype but with abnormalities in WBC counts and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310016G11Rik A G 7: 44,677,196 noncoding transcript Het
5830411N06Rik G A 7: 140,296,397 R594H probably benign Het
Abcc5 T A 16: 20,378,661 K647* probably null Het
Aplp1 A G 7: 30,435,816 probably benign Het
Arhgef25 A G 10: 127,189,554 I43T probably benign Het
AU019823 A C 9: 50,610,425 D65E probably damaging Het
BC003965 A G 17: 25,184,983 E99G possibly damaging Het
Brinp3 T G 1: 146,901,451 S545R probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
C5ar2 A G 7: 16,237,676 F109L probably benign Het
D630045J12Rik G A 6: 38,183,967 Q1081* probably null Het
Dhx36 T C 3: 62,477,595 I699V possibly damaging Het
Dnah9 A G 11: 65,969,979 I2855T probably benign Het
Dock8 T C 19: 25,163,047 I1317T probably benign Het
Galnt11 A T 5: 25,248,857 D27V probably damaging Het
Gm5134 T A 10: 75,993,884 C335S probably damaging Het
Hdhd2 A T 18: 76,970,615 K227N probably damaging Het
Impg1 A T 9: 80,435,426 L36Q probably damaging Het
Krtcap3 A G 5: 31,252,959 H227R probably benign Het
Lrrc7 A G 3: 158,160,661 Y1148H probably damaging Het
Map2k4 A G 11: 65,712,284 I174T probably damaging Het
Mef2c C A 13: 83,656,240 L282M probably damaging Het
Pdgfrb T A 18: 61,064,926 probably benign Het
Phf7 C T 14: 31,238,486 probably benign Het
Plac8 T A 5: 100,556,568 T88S probably benign Het
Pou2f1 G A 1: 165,876,018 T654M probably damaging Het
Ptprk T A 10: 28,592,895 V1425E probably damaging Het
Saal1 A T 7: 46,692,892 S376T probably damaging Het
Serpini1 T C 3: 75,619,313 Y291H probably damaging Het
Siah2 T C 3: 58,676,292 H191R probably benign Het
Spaca6 T A 17: 17,838,236 Y39* probably null Het
Tbc1d10a T C 11: 4,213,680 C277R probably damaging Het
Trim45 A T 3: 100,925,420 D323V probably damaging Het
Trim55 A C 3: 19,644,702 M32L probably benign Het
Unc5b T C 10: 60,778,919 T200A probably benign Het
V1rd19 A T 7: 24,003,604 D165V probably damaging Het
Other mutations in Nqo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Nqo2 APN 13 33985343 nonsense probably null
IGL02884:Nqo2 APN 13 33972361 missense probably damaging 1.00
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0848:Nqo2 UTSW 13 33972478 critical splice donor site probably null
R0853:Nqo2 UTSW 13 33979577 missense probably benign
R3417:Nqo2 UTSW 13 33979633 missense probably benign 0.01
R4110:Nqo2 UTSW 13 33979637 missense probably benign 0.00
R4936:Nqo2 UTSW 13 33981518 missense probably damaging 1.00
R5861:Nqo2 UTSW 13 33972430 missense probably damaging 1.00
R6161:Nqo2 UTSW 13 33979651 missense probably damaging 0.99
R6599:Nqo2 UTSW 13 33979556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTGCCTACTGGGTGCTATCG -3'
(R):5'- GGATGATTGTGCCATGAAGGTCAGC -3'

Sequencing Primer
(F):5'- ACTGGGTGCTATCGGAGGAG -3'
(R):5'- ATTAGTGTGGATGGATAACCCCC -3'
Posted On2014-08-08