Incidental Mutation 'R0122:Vmn2r98'
ID218450
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 038407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0122 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19066400 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 387 (I387V)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: I387V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: I387V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Adam12 T A 7: 134,012,348 I60F probably benign Het
Adamts10 A G 17: 33,528,480 probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Adamts7 A G 9: 90,179,421 E360G probably damaging Het
Atn1 A T 6: 124,743,234 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Baz2b G T 2: 59,913,619 probably null Het
Bloc1s6 G C 2: 122,746,043 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qa T A 4: 136,897,831 T3S probably benign Het
Cacna1e A T 1: 154,443,901 F1351Y probably damaging Het
Car9 C T 4: 43,512,206 A356V probably benign Het
Ccdc116 T A 16: 17,142,734 D73V probably damaging Het
Ces2g T C 8: 104,968,300 Y518H probably damaging Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cmc1 A T 9: 118,065,320 C29S probably damaging Het
Coil T A 11: 88,985,007 probably benign Het
Col3a1 C T 1: 45,340,897 probably benign Het
Cox15 A G 19: 43,748,790 I135T possibly damaging Het
Cyld T C 8: 88,742,292 S564P probably damaging Het
Dnah5 T A 15: 28,378,363 N2948K probably damaging Het
Dnah7a G A 1: 53,397,142 R4014W probably damaging Het
Dnmt3b T C 2: 153,676,698 Y594H probably damaging Het
Dntt A G 19: 41,053,038 K387R possibly damaging Het
Efcab7 G A 4: 99,892,363 probably benign Het
Flvcr1 G T 1: 191,021,226 P250T possibly damaging Het
Gga2 C A 7: 121,991,574 V504L probably damaging Het
Gm12239 T A 11: 56,015,912 noncoding transcript Het
Gm13089 A T 4: 143,698,404 D156E probably benign Het
Gm6327 T C 16: 12,761,026 noncoding transcript Het
Krt26 G T 11: 99,333,719 Y324* probably null Het
Lamb2 A T 9: 108,486,514 H939L probably benign Het
Lipo3 C T 19: 33,622,686 probably benign Het
Mmp1b G A 9: 7,386,689 T145M probably damaging Het
Mrps27 G T 13: 99,365,228 V76L probably benign Het
Mup6 T A 4: 60,003,995 Y29* probably null Het
Nlrc3 T C 16: 3,958,958 K756E probably damaging Het
Nnt T C 13: 119,368,597 H527R probably damaging Het
Nudt8 T C 19: 4,001,306 V59A probably benign Het
Ofcc1 A T 13: 40,280,556 probably null Het
Olfr447 T C 6: 42,911,955 V144A probably benign Het
Olfr638 T C 7: 104,003,358 W28R probably damaging Het
Olfr959 A T 9: 39,572,724 D178E probably damaging Het
Pdgfd T C 9: 6,293,851 S142P probably damaging Het
Pias4 G T 10: 81,157,087 Q22K probably damaging Het
Pin1 T C 9: 20,662,304 I95T probably benign Het
Prickle2 G A 6: 92,411,345 Q359* probably null Het
Qrich2 G T 11: 116,446,813 Q1950K possibly damaging Het
Rab10 C A 12: 3,309,357 G21V probably damaging Het
Rbm27 T A 18: 42,313,968 probably benign Het
Samd4 C A 14: 47,016,560 S160R probably benign Het
Scube3 A C 17: 28,166,528 probably benign Het
Serpinf2 A G 11: 75,436,546 L185P probably damaging Het
Slc16a12 A G 19: 34,674,864 I294T probably benign Het
Slc45a3 T A 1: 131,977,740 M167K probably damaging Het
Sspo T A 6: 48,473,976 L2673Q possibly damaging Het
Supt3 A G 17: 45,003,141 D139G probably damaging Het
Tas1r3 T C 4: 155,860,833 M644V probably benign Het
Tgfbi A G 13: 56,627,968 T276A probably damaging Het
Tmem177 T C 1: 119,910,578 I124V probably benign Het
Tmprss11f G T 5: 86,533,625 probably benign Het
Tmprss3 G A 17: 31,193,902 probably benign Het
Twf1 A G 15: 94,586,549 probably benign Het
Uba52 T A 8: 70,509,301 Q166L probably damaging Het
Ubr3 G T 2: 69,979,412 G1242V probably damaging Het
Unc13d C T 11: 116,065,482 S835N probably benign Het
Ush2a A G 1: 188,948,455 K4877E possibly damaging Het
Vps11 A T 9: 44,354,512 I490N probably damaging Het
Vstm4 T A 14: 32,863,811 probably null Het
Zfp110 C A 7: 12,848,597 H391N possibly damaging Het
Zfp212 C T 6: 47,931,023 P312L possibly damaging Het
Zfp329 A T 7: 12,810,987 H203Q probably damaging Het
Zscan12 G A 13: 21,368,969 G321E probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGAAATGGCATCTGCCTAGCTTTTG -3'
(R):5'- AAAGCGTATTTGCTCCTGGTATCTTGT -3'

Sequencing Primer
(F):5'- GGGAGCCTCATTTTTAAGCAC -3'
(R):5'- GCATAACTCTTATGCCAGATTGCTG -3'
Posted On2014-08-11