Incidental Mutation 'R0050:Stx2'
ID218457
Institutional Source Beutler Lab
Gene Symbol Stx2
Ensembl Gene ENSMUSG00000029428
Gene Namesyntaxin 2
Synonymsrepro34, G1-536-1, Syn-2, Epim
MMRRC Submission 038344-MU
Accession Numbers

Ncbi RefSeq: NM_007941.2; MGI:108059

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0050 (G1)
Quality Score39
Status Validated
Chromosome5
Chromosomal Location128984557-129008574 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 128999508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031378] [ENSMUST00000100680] [ENSMUST00000149877] [ENSMUST00000195906]
Predicted Effect probably null
Transcript: ENSMUST00000031378
SMART Domains Protein: ENSMUSP00000031378
Gene: ENSMUSG00000029428

DomainStartEndE-ValueType
SynN 25 146 1.33e-40 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 175 185 N/A INTRINSIC
t_SNARE 187 254 1.74e-19 SMART
transmembrane domain 266 288 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100680
SMART Domains Protein: ENSMUSP00000098247
Gene: ENSMUSG00000029428

DomainStartEndE-ValueType
SynN 25 146 1.33e-40 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 175 185 N/A INTRINSIC
t_SNARE 187 254 1.74e-19 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141492
Predicted Effect probably null
Transcript: ENSMUST00000149877
SMART Domains Protein: ENSMUSP00000118220
Gene: ENSMUSG00000029428

DomainStartEndE-ValueType
Pfam:Syntaxin 1 85 1.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151712
Predicted Effect probably benign
Transcript: ENSMUST00000195906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199813
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (54/55)
MGI Phenotype Strain: 3526405
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the syntaxin/epimorphin family of proteins. The syntaxins are a large protein family implicated in the targeting and fusion of intracellular transport vesicles. The product of this gene regulates epithelial-mesenchymal interactions and epithelial cell morphogenesis and activation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display male infertility associated with abnormal testicular development and impaired spermatogenesis, increased intestinal growth due to enhanced crypt cell proliferation and crypt fission, and decreased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(4) Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C T 11: 110,145,591 C564Y probably damaging Het
Adamts2 T C 11: 50,775,395 V406A probably damaging Het
Ankar T A 1: 72,656,164 E1093D probably damaging Het
Arhgef38 C A 3: 133,132,196 D75Y probably damaging Het
Atg4b T A 1: 93,787,718 probably benign Het
Cadm2 A G 16: 66,953,266 probably benign Het
Ces2c T A 8: 104,848,199 M96K probably benign Het
Dmrt3 C A 19: 25,622,589 P266H probably damaging Het
Dock9 A G 14: 121,607,225 V1124A probably benign Het
Edem1 T C 6: 108,828,848 F37L possibly damaging Het
Ermp1 C A 19: 29,628,784 A190S probably damaging Het
Gm10267 T A 18: 44,156,453 probably benign Het
Gm11492 T C 11: 87,567,346 L182S probably damaging Het
Golga2 T A 2: 32,292,127 V29D probably damaging Het
Gprc6a T A 10: 51,615,389 M755L probably damaging Het
H1foo G T 6: 115,947,768 K78N probably damaging Het
Lama3 T A 18: 12,404,103 H268Q probably damaging Het
Lrriq1 A G 10: 103,068,931 V1614A probably damaging Het
Oaz2 A G 9: 65,687,802 E61G probably damaging Het
Pear1 G T 3: 87,755,987 Y441* probably null Het
Pkhd1l1 A T 15: 44,573,807 T3493S possibly damaging Het
Plekhg5 T C 4: 152,108,088 probably null Het
Ppp3cb A G 14: 20,531,752 V65A possibly damaging Het
Rheb A T 5: 24,817,834 probably benign Het
Ros1 G A 10: 52,101,803 T1449M probably damaging Het
Slc6a12 T C 6: 121,360,419 probably benign Het
Tnxb T A 17: 34,673,325 D764E probably damaging Het
Trmt2a A T 16: 18,250,843 E234D probably damaging Het
Other mutations in Stx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Stx2 APN 5 128990978 missense probably benign 0.01
IGL01951:Stx2 APN 5 128992265 missense probably damaging 1.00
IGL02348:Stx2 APN 5 128988830 missense probably damaging 1.00
IGL02902:Stx2 APN 5 128992221 missense probably damaging 1.00
R0050:Stx2 UTSW 5 128999508 critical splice donor site probably null
R0277:Stx2 UTSW 5 128988903 missense probably benign 0.00
R0323:Stx2 UTSW 5 128988903 missense probably benign 0.00
R0419:Stx2 UTSW 5 128993577 splice site probably benign
R0843:Stx2 UTSW 5 128999548 missense probably damaging 1.00
R1346:Stx2 UTSW 5 128988788 unclassified probably benign
R1631:Stx2 UTSW 5 128992225 missense probably damaging 1.00
R1920:Stx2 UTSW 5 128988839 missense probably damaging 1.00
R5350:Stx2 UTSW 5 128991091 missense probably damaging 1.00
R6877:Stx2 UTSW 5 128987820 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTGACGATGCTGAAAGTCCCC -3'
(R):5'- ATGGCCCTGACTCTGGTGTAGATG -3'

Sequencing Primer
(F):5'- ggcaggaggatggcaag -3'
(R):5'- TTCTGTCACCAGGTAGAAGC -3'
Posted On2014-08-11