Incidental Mutation 'R0050:Slc6a12'
ID218459
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Namesolute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
SynonymsBGT1, Gabt2
MMRRC Submission 038344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0050 (G1)
Quality Score79
Status Validated
Chromosome6
Chromosomal Location121343076-121365775 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 121360419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166457] [ENSMUST00000171008]
Predicted Effect probably benign
Transcript: ENSMUST00000032200
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163771
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165456
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166457
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Predicted Effect probably benign
Transcript: ENSMUST00000171008
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C T 11: 110,145,591 C564Y probably damaging Het
Adamts2 T C 11: 50,775,395 V406A probably damaging Het
Ankar T A 1: 72,656,164 E1093D probably damaging Het
Arhgef38 C A 3: 133,132,196 D75Y probably damaging Het
Atg4b T A 1: 93,787,718 probably benign Het
Cadm2 A G 16: 66,953,266 probably benign Het
Ces2c T A 8: 104,848,199 M96K probably benign Het
Dmrt3 C A 19: 25,622,589 P266H probably damaging Het
Dock9 A G 14: 121,607,225 V1124A probably benign Het
Edem1 T C 6: 108,828,848 F37L possibly damaging Het
Ermp1 C A 19: 29,628,784 A190S probably damaging Het
Gm10267 T A 18: 44,156,453 probably benign Het
Gm11492 T C 11: 87,567,346 L182S probably damaging Het
Golga2 T A 2: 32,292,127 V29D probably damaging Het
Gprc6a T A 10: 51,615,389 M755L probably damaging Het
H1foo G T 6: 115,947,768 K78N probably damaging Het
Lama3 T A 18: 12,404,103 H268Q probably damaging Het
Lrriq1 A G 10: 103,068,931 V1614A probably damaging Het
Oaz2 A G 9: 65,687,802 E61G probably damaging Het
Pear1 G T 3: 87,755,987 Y441* probably null Het
Pkhd1l1 A T 15: 44,573,807 T3493S possibly damaging Het
Plekhg5 T C 4: 152,108,088 probably null Het
Ppp3cb A G 14: 20,531,752 V65A possibly damaging Het
Rheb A T 5: 24,817,834 probably benign Het
Ros1 G A 10: 52,101,803 T1449M probably damaging Het
Stx2 A G 5: 128,999,508 probably null Het
Tnxb T A 17: 34,673,325 D764E probably damaging Het
Trmt2a A T 16: 18,250,843 E234D probably damaging Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121360455 missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121352056 missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121353501 missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121354375 splice site probably null
IGL02498:Slc6a12 APN 6 121361070 missense probably benign
IGL02537:Slc6a12 APN 6 121360514 missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121363252 missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121354287 missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121357045 missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0201:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0302:Slc6a12 UTSW 6 121363259 missense probably damaging 1.00
R0317:Slc6a12 UTSW 6 121358625 missense possibly damaging 0.80
R0394:Slc6a12 UTSW 6 121346998 critical splice donor site probably null
R0492:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0532:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R1421:Slc6a12 UTSW 6 121359126 missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121363757 nonsense probably null
R1879:Slc6a12 UTSW 6 121347423 missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121347443 nonsense probably null
R1925:Slc6a12 UTSW 6 121360526 missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121354280 critical splice acceptor site probably null
R4515:Slc6a12 UTSW 6 121353530 critical splice donor site probably null
R4559:Slc6a12 UTSW 6 121363861 splice site probably null
R4628:Slc6a12 UTSW 6 121351992 nonsense probably null
R4665:Slc6a12 UTSW 6 121359013 splice site probably benign
R4753:Slc6a12 UTSW 6 121356903 splice site probably benign
R4948:Slc6a12 UTSW 6 121355322 missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121354339 missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121354303 missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121365319 missense probably benign
R7318:Slc6a12 UTSW 6 121352013 missense probably damaging 0.99
R7318:Slc6a12 UTSW 6 121352019 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCTGACATGCACAGAATCTCATAGAC -3'
(R):5'- CCAGGCTAAAGACTCGAACCATAGTG -3'

Sequencing Primer
(F):5'- cacagacacacatagatacacac -3'
(R):5'- CTCCGGTCAGGGAGAAGG -3'
Posted On2014-08-11