Incidental Mutation 'R0050:Abca9'
ID218465
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
MMRRC Submission 038344-MU
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0050 (G1)
Quality Score27
Status Validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110145591 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 564 (C564Y)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect probably damaging
Transcript: ENSMUST00000044850
AA Change: C564Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: C564Y

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 T C 11: 50,775,395 V406A probably damaging Het
Ankar T A 1: 72,656,164 E1093D probably damaging Het
Arhgef38 C A 3: 133,132,196 D75Y probably damaging Het
Atg4b T A 1: 93,787,718 probably benign Het
Cadm2 A G 16: 66,953,266 probably benign Het
Ces2c T A 8: 104,848,199 M96K probably benign Het
Dmrt3 C A 19: 25,622,589 P266H probably damaging Het
Dock9 A G 14: 121,607,225 V1124A probably benign Het
Edem1 T C 6: 108,828,848 F37L possibly damaging Het
Ermp1 C A 19: 29,628,784 A190S probably damaging Het
Gm10267 T A 18: 44,156,453 probably benign Het
Gm11492 T C 11: 87,567,346 L182S probably damaging Het
Golga2 T A 2: 32,292,127 V29D probably damaging Het
Gprc6a T A 10: 51,615,389 M755L probably damaging Het
H1foo G T 6: 115,947,768 K78N probably damaging Het
Lama3 T A 18: 12,404,103 H268Q probably damaging Het
Lrriq1 A G 10: 103,068,931 V1614A probably damaging Het
Oaz2 A G 9: 65,687,802 E61G probably damaging Het
Pear1 G T 3: 87,755,987 Y441* probably null Het
Pkhd1l1 A T 15: 44,573,807 T3493S possibly damaging Het
Plekhg5 T C 4: 152,108,088 probably null Het
Ppp3cb A G 14: 20,531,752 V65A possibly damaging Het
Rheb A T 5: 24,817,834 probably benign Het
Ros1 G A 10: 52,101,803 T1449M probably damaging Het
Slc6a12 T C 6: 121,360,419 probably benign Het
Stx2 A G 5: 128,999,508 probably null Het
Tnxb T A 17: 34,673,325 D764E probably damaging Het
Trmt2a A T 16: 18,250,843 E234D probably damaging Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4411:Abca9 UTSW 11 110151955 missense probably benign 0.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4720:Abca9 UTSW 11 110127422 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5350:Abca9 UTSW 11 110115538 missense probably benign
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5872:Abca9 UTSW 11 110117076 missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6481:Abca9 UTSW 11 110165962 nonsense probably null
R6675:Abca9 UTSW 11 110115476 missense probably benign
R6909:Abca9 UTSW 11 110115497 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCGATCCCAAGAGTCAACTTCC -3'
(R):5'- CACCTGCTGTGTGTTGCAAATCTG -3'

Sequencing Primer
(F):5'- actttagcaagactcctgcc -3'
(R):5'- CCTGTACTTCCTCTGTACAGGTT -3'
Posted On2014-08-11