Incidental Mutation 'R0135:Ttll4'
ID21848
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Nametubulin tyrosine ligase-like family, member 4
Synonyms4632407P03Rik
MMRRC Submission 038420-MU
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location74661745-74703730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74679928 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 313 (H313N)
Ref Sequence ENSEMBL: ENSMUSP00000109308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: H313N

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: H313N

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113678
AA Change: H313N

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: H313N

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
Brwd1 A C 16: 96,047,104 N572K probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dgcr2 A G 16: 17,858,442 S152P probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Glp1r A G 17: 30,924,577 I196V probably benign Het
Gm884 C A 11: 103,618,047 probably benign Het
Grm6 G A 11: 50,853,223 E174K probably damaging Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Retsat A G 6: 72,602,772 T177A probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Tnik T G 3: 28,607,245 N598K possibly damaging Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Vipr2 A G 12: 116,142,827 I348V probably benign Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 unclassified probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 unclassified probably null
R2876:Ttll4 UTSW 1 74686438 unclassified probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74688661 missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74687259 missense not run
Predicted Primers PCR Primer
(F):5'- ACAAGCCACAGATGGCCTGAAG -3'
(R):5'- TGTTGAGAAGACCCCACTGGAAGC -3'

Sequencing Primer
(F):5'- ATGGCCTGAAGCCAGTATC -3'
(R):5'- ACTGGAAGCTGGGGTTCAC -3'
Posted On2013-04-12