Incidental Mutation 'R0580:Adgrg5'
ID218513
Institutional Source Beutler Lab
Gene Symbol Adgrg5
Ensembl Gene ENSMUSG00000061577
Gene Nameadhesion G protein-coupled receptor G5
SynonymsGpr114, PGR27, LOC382045
MMRRC Submission 038770-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0580 (G1)
Quality Score70
Status Validated
Chromosome8
Chromosomal Location94923694-94943280 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94937344 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074570] [ENSMUST00000074570] [ENSMUST00000128308] [ENSMUST00000128308] [ENSMUST00000153448] [ENSMUST00000166802] [ENSMUST00000166802]
Predicted Effect probably null
Transcript: ENSMUST00000074570
SMART Domains Protein: ENSMUSP00000074155
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 4.7e-13 SMART
Pfam:7tm_2 240 494 2.1e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074570
SMART Domains Protein: ENSMUSP00000074155
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 4.7e-13 SMART
Pfam:7tm_2 240 494 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128308
SMART Domains Protein: ENSMUSP00000120217
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128308
SMART Domains Protein: ENSMUSP00000120217
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142991
Predicted Effect probably benign
Transcript: ENSMUST00000153448
SMART Domains Protein: ENSMUSP00000122780
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166802
SMART Domains Protein: ENSMUSP00000132628
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 1.37e-14 SMART
Pfam:7tm_2 241 495 1.3e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166802
SMART Domains Protein: ENSMUSP00000132628
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 1.37e-14 SMART
Pfam:7tm_2 241 495 1.3e-36 PFAM
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion family of G-protein coupled receptors. Members of this family are characterized by long N-termini and multiple functional domains. They may play a role in the immune system as well as in the central nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C T 17: 46,305,956 probably null Het
Akap12 A T 10: 4,354,741 D517V possibly damaging Het
Arhgap23 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 97,446,536 probably null Het
Bpi A T 2: 158,258,295 M1L probably damaging Het
Carm1 C T 9: 21,583,584 P339S probably damaging Het
Chchd3 A C 6: 32,893,390 probably null Het
Chd9 T C 8: 90,994,563 V520A possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Col10a1 A G 10: 34,394,952 R307G probably benign Het
Cpeb3 T C 19: 37,174,035 T314A probably benign Het
Csmd1 A T 8: 15,910,528 Y3296N probably damaging Het
Dtx2 A T 5: 136,032,326 T521S probably damaging Het
Ext2 A T 2: 93,795,725 V330E probably benign Het
Extl3 A G 14: 65,075,729 L668P probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gm8298 T A 3: 59,877,049 D314E probably damaging Het
Grm8 A G 6: 27,761,371 probably benign Het
Herc2 T A 7: 56,138,791 V1763D probably damaging Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqce A G 5: 140,665,401 F768L possibly damaging Het
Kntc1 G A 5: 123,803,669 V1809I probably benign Het
Lyzl1 A C 18: 4,181,134 T58P probably damaging Het
Mlxipl A G 5: 135,123,975 T287A probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Net1 A G 13: 3,886,612 Y264H probably damaging Het
Nnmt T C 9: 48,592,300 D142G probably damaging Het
Nod2 T A 8: 88,664,406 I432N probably damaging Het
Olfr1393 T A 11: 49,280,622 I158N probably damaging Het
Olfr711 A G 7: 106,972,240 Y35H probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pign A C 1: 105,591,694 I501S probably benign Het
Scgb2b19 A T 7: 33,278,570 S101T probably benign Het
Slc7a5 A T 8: 121,885,116 M391K probably benign Het
Sptan1 A G 2: 30,007,575 R1217G probably damaging Het
Srgap2 A G 1: 131,349,501 V336A possibly damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Syt10 A T 15: 89,827,176 D51E probably benign Het
Vmn2r96 T C 17: 18,582,638 V270A probably damaging Het
Other mutations in Adgrg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Adgrg5 APN 8 94937629 missense probably damaging 1.00
IGL02617:Adgrg5 APN 8 94933982 missense probably benign 0.01
R0483:Adgrg5 UTSW 8 94933508 missense possibly damaging 0.73
R0539:Adgrg5 UTSW 8 94938632 missense probably damaging 1.00
R0650:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0652:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0828:Adgrg5 UTSW 8 94941785 splice site probably null
R1546:Adgrg5 UTSW 8 94941630 missense probably benign 0.27
R1567:Adgrg5 UTSW 8 94937698 missense probably damaging 0.97
R1695:Adgrg5 UTSW 8 94937745 missense probably damaging 1.00
R1753:Adgrg5 UTSW 8 94942052 missense possibly damaging 0.65
R1852:Adgrg5 UTSW 8 94937800 missense probably damaging 1.00
R2018:Adgrg5 UTSW 8 94934480 missense probably damaging 1.00
R2051:Adgrg5 UTSW 8 94942067 missense probably benign 0.01
R2190:Adgrg5 UTSW 8 94933951 missense probably damaging 1.00
R2299:Adgrg5 UTSW 8 94938576 missense possibly damaging 0.88
R2568:Adgrg5 UTSW 8 94934021 missense probably damaging 0.99
R4283:Adgrg5 UTSW 8 94937698 missense probably benign 0.21
R4512:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R4825:Adgrg5 UTSW 8 94941734 missense possibly damaging 0.77
R5422:Adgrg5 UTSW 8 94933952 missense probably damaging 1.00
R5427:Adgrg5 UTSW 8 94935102 missense probably benign 0.27
R6186:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R6522:Adgrg5 UTSW 8 94942068 missense probably benign 0.13
R6608:Adgrg5 UTSW 8 94941720 missense probably damaging 1.00
R6810:Adgrg5 UTSW 8 94933942 missense probably damaging 0.97
R6816:Adgrg5 UTSW 8 94941683 missense probably damaging 0.99
R7214:Adgrg5 UTSW 8 94934018 missense
X0027:Adgrg5 UTSW 8 94937338 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGGCAAAGACCATGATGCAGGC -3'
(R):5'- TGTGGGTAGGACATCACCCAGATAG -3'

Sequencing Primer
(F):5'- ATGATGCAGGCTACAGCTTC -3'
(R):5'- CTCACAACGATGGGGAAACTG -3'
Posted On2014-08-14