Incidental Mutation 'R0667:Mep1a'
ID218562
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Namemeprin 1 alpha
SynonymsMep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0667 (G1)
Quality Score50
Status Validated
Chromosome17
Chromosomal Location43474324-43502812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43478190 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 565 (D565A)
Ref Sequence ENSEMBL: ENSMUSP00000113838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
PDB Structure
[]
Predicted Effect probably benign
Transcript: ENSMUST00000024707
AA Change: D578A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: D578A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117137
AA Change: D565A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: D565A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAATCAATAGACCAGTCAGAGCCT -3'
(R):5'- GTGCATAGCAGTGACACAGTGATATGA -3'

Sequencing Primer
(F):5'- GTCAGAGCCTAAGATTATTGACCCAG -3'
(R):5'- agagagagagagagagagagaaag -3'
Posted On2014-08-18