Incidental Mutation 'R0675:Mroh2a'
ID218599
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 038860-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R0675 (G1)
Quality Score33
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88228380 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 78 (A78E)
Ref Sequence ENSEMBL: ENSMUSP00000130508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
Predicted Effect probably damaging
Transcript: ENSMUST00000061013
AA Change: A78E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: A78E

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113130
AA Change: A78E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: A78E

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148474
Meta Mutation Damage Score 0.0384 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,776 E140G probably benign Het
4932431P20Rik T C 7: 29,532,517 noncoding transcript Het
Ablim2 C T 5: 35,866,780 probably benign Het
Aire T C 10: 78,034,493 probably benign Het
Akap12 T C 10: 4,353,315 S42P probably benign Het
Amigo1 T C 3: 108,191,669 probably benign Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Ank1 T A 8: 23,110,384 probably benign Het
Ano5 A T 7: 51,574,810 T472S probably damaging Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Cd200 T C 16: 45,397,110 I73V probably benign Het
Cd47 T C 16: 49,906,799 I318T possibly damaging Het
Cep290 A G 10: 100,568,813 probably null Het
Cep350 A G 1: 155,959,753 S66P possibly damaging Het
Cfap46 C T 7: 139,676,034 C300Y probably damaging Het
Chd1 T A 17: 15,758,261 probably benign Het
Chd5 C A 4: 152,385,950 T1913K probably benign Het
Clec4b1 A G 6: 123,071,446 Y180C probably damaging Het
Cntnap5c A T 17: 58,034,995 D227V probably damaging Het
Col19a1 C G 1: 24,575,455 probably benign Het
Csmd1 A T 8: 16,158,131 M1270K probably benign Het
Cyp2c66 T A 19: 39,186,616 F487I possibly damaging Het
Dpp8 T C 9: 65,066,502 probably benign Het
Duoxa1 A T 2: 122,306,380 probably benign Het
Edil3 A G 13: 89,177,280 K263E probably damaging Het
Fat2 A G 11: 55,309,209 L1013P probably damaging Het
Fras1 T C 5: 96,667,387 probably benign Het
Gab1 A G 8: 80,769,668 S668P probably damaging Het
Galnt14 T C 17: 73,545,035 T130A probably damaging Het
Gm10192 G A 4: 97,182,872 H99Y unknown Het
Gm5592 A G 7: 41,289,387 T698A possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gsdma3 A G 11: 98,631,191 K149R probably benign Het
Igkv4-71 A G 6: 69,243,427 S29P probably damaging Het
Igsf10 C T 3: 59,328,594 V1389I probably benign Het
Ik T C 18: 36,747,333 probably benign Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqsec2 G A X: 152,204,124 E398K possibly damaging Het
Jmjd6 A G 11: 116,840,527 V232A probably damaging Het
Klhdc9 G A 1: 171,360,327 T112M possibly damaging Het
Marcks A G 10: 37,141,185 probably benign Het
Mctp2 T A 7: 72,083,170 T829S probably damaging Het
Mtmr14 A T 6: 113,270,647 H518L probably damaging Het
Mum1 T A 10: 80,230,080 V56E probably damaging Het
Myo5c T C 9: 75,278,289 M978T probably benign Het
Nlrc3 T C 16: 3,948,911 I1015V probably benign Het
Nlrp5 C A 7: 23,417,417 Q189K possibly damaging Het
Olfr1082 T C 2: 86,594,079 I250V probably benign Het
Olfr385 A C 11: 73,589,252 L162R probably damaging Het
Olfr583 A G 7: 103,051,702 I135V probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Otof T A 5: 30,382,361 Y1051F probably benign Het
Pcdhb14 C A 18: 37,448,339 T166K possibly damaging Het
Pla2g4e A G 2: 120,200,198 probably benign Het
Polr3gl T C 3: 96,582,155 E20G probably damaging Het
Psmd1 A G 1: 86,082,039 D295G probably benign Het
Ptpn21 C A 12: 98,688,216 A831S probably benign Het
Rd3l T C 12: 111,980,162 D60G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,441,834 D2624G probably benign Het
Sec31a T C 5: 100,393,207 D347G probably damaging Het
Sema4g G A 19: 44,997,587 R289H probably damaging Het
Sema5b C T 16: 35,660,333 T761I probably benign Het
Sept1 A T 7: 127,216,999 F86L probably damaging Het
Shank3 T C 15: 89,531,388 V627A possibly damaging Het
Slc25a46 C A 18: 31,609,588 G75V probably benign Het
Slc45a2 T A 15: 11,025,778 Y405N probably damaging Het
Spidr T C 16: 16,037,634 E339G probably damaging Het
Sptbn1 A T 11: 30,117,903 H1770Q probably damaging Het
Srgap1 T C 10: 121,792,235 Y944C probably damaging Het
Supt20 C T 3: 54,706,969 T169I probably damaging Het
Tie1 G A 4: 118,479,769 Q587* probably null Het
Tmem214 A G 5: 30,871,825 T203A possibly damaging Het
Tmprss15 C A 16: 78,985,950 S742I probably damaging Het
Zfhx2 A G 14: 55,063,163 V2377A probably damaging Het
Zfp763 G A 17: 33,019,800 H124Y possibly damaging Het
Zfp846 T C 9: 20,593,557 S238P probably benign Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCATCTTGAAGGCACTTGAGGAGAC -3'
(R):5'- ACCCCAACTAGCCCTGAGGAATATG -3'

Sequencing Primer
(F):5'- AGCAGAGCATCTGGCACTTC -3'
(R):5'- CCCTGAGGAATATGAGTGCC -3'
Posted On2014-08-18