Incidental Mutation 'R0135:Tnik'
ID21861
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
MMRRC Submission 038420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28607245 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 598 (N598K)
Ref Sequence ENSEMBL: ENSMUSP00000124681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: N598K

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: N598K

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159308
AA Change: N543K

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: N543K

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159680
AA Change: N627K

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: N627K

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160307
AA Change: N627K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: N627K

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160518
AA Change: N598K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: N598K

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161964
AA Change: N543K
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: N543K

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect possibly damaging
Transcript: ENSMUST00000162485
AA Change: N572K

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: N572K

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162777
AA Change: N572K
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: N572K

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
Brwd1 A C 16: 96,047,104 N572K probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dgcr2 A G 16: 17,858,442 S152P probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Glp1r A G 17: 30,924,577 I196V probably benign Het
Gm884 C A 11: 103,618,047 probably benign Het
Grm6 G A 11: 50,853,223 E174K probably damaging Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Retsat A G 6: 72,602,772 T177A probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Ttll4 C A 1: 74,679,928 H313N possibly damaging Het
Vipr2 A G 12: 116,142,827 I348V probably benign Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAACTGAAAACTGCCCTGTCG -3'
(R):5'- AGAAGGAAGGTGTTGTTGCACAGTC -3'

Sequencing Primer
(F):5'- aaaactGCCCTGTCGTAGCTC -3'
(R):5'- AGGTGTTGTTGCACAGTCAAATTC -3'
Posted On2013-04-12