Incidental Mutation 'R0684:Sema3a'
ID 218625
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms Semad, collapsin-1, SemD, sema III, semaphorin III
MMRRC Submission 038869-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R0684 (G1)
Quality Score 43
Status Validated
Chromosome 5
Chromosomal Location 13175381-13652533 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to A at 13606494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000095012] [ENSMUST00000137798] [ENSMUST00000137798]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000030714
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000030714
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095012
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095012
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137798
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137798
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197552
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,466,428 (GRCm39) L731H probably damaging Het
Adora2b C T 11: 62,139,995 (GRCm39) A23V probably benign Het
Ankrd17 T C 5: 90,411,857 (GRCm39) I1336V probably damaging Het
Asxl1 G A 2: 153,239,442 (GRCm39) R410H probably damaging Het
Atp8a2 T C 14: 60,260,593 (GRCm39) E419G probably benign Het
Atxn1l A T 8: 110,459,016 (GRCm39) N415K probably damaging Het
Bcl2l12 T A 7: 44,646,025 (GRCm39) T65S probably benign Het
Bdh2 A G 3: 134,996,774 (GRCm39) I90V probably benign Het
Bsph1 T A 7: 13,206,988 (GRCm39) N121K probably damaging Het
Cd96 T C 16: 45,938,153 (GRCm39) Y104C possibly damaging Het
Chdh T C 14: 29,753,570 (GRCm39) W160R probably damaging Het
Clock A G 5: 76,393,365 (GRCm39) F193L probably damaging Het
Copz1 A G 15: 103,204,958 (GRCm39) probably null Het
Cyp2c38 T C 19: 39,379,500 (GRCm39) T450A probably damaging Het
Cyp2d34 A T 15: 82,501,751 (GRCm39) I253K probably benign Het
Dhrs13 G T 11: 77,927,789 (GRCm39) A212S probably damaging Het
Ecsit T C 9: 21,987,796 (GRCm39) N81S probably benign Het
Efl1 A G 7: 82,301,094 (GRCm39) T33A probably damaging Het
Emid1 T C 11: 5,093,866 (GRCm39) R92G probably damaging Het
Ermp1 A G 19: 29,609,941 (GRCm39) probably benign Het
Fn1 A T 1: 71,634,968 (GRCm39) probably null Het
Hps5 A G 7: 46,432,893 (GRCm39) probably null Het
Hsd17b3 T C 13: 64,236,882 (GRCm39) M21V probably benign Het
Kat6b T C 14: 21,718,849 (GRCm39) V1176A probably benign Het
Midn A G 10: 79,992,336 (GRCm39) K463E probably damaging Het
Mier1 A G 4: 102,996,631 (GRCm39) E103G probably damaging Het
Muc15 A G 2: 110,564,160 (GRCm39) N232S possibly damaging Het
Ncoa2 T A 1: 13,294,875 (GRCm39) E15V probably damaging Het
Or10a5 A T 7: 106,635,889 (GRCm39) N176Y probably damaging Het
Or2n1d A G 17: 38,646,735 (GRCm39) K229R probably benign Het
Or52n2b T A 7: 104,565,841 (GRCm39) T221S probably benign Het
Pate14 C T 9: 36,549,176 (GRCm39) G28E probably benign Het
Pigf A T 17: 87,327,923 (GRCm39) F115I probably benign Het
Prpsap1 A T 11: 116,362,317 (GRCm39) V355E probably damaging Het
Ptprk G T 10: 28,359,294 (GRCm39) probably benign Het
Rae1 G A 2: 172,846,957 (GRCm39) R67H probably damaging Het
Slc22a22 T C 15: 57,126,758 (GRCm39) T104A probably benign Het
Slc38a2 A T 15: 96,593,168 (GRCm39) L137* probably null Het
Smgc A G 15: 91,725,670 (GRCm39) probably benign Het
Syce3 A G 15: 89,274,648 (GRCm39) probably benign Het
Syt9 T A 7: 107,024,343 (GRCm39) W79R probably damaging Het
Tgoln1 A C 6: 72,592,974 (GRCm39) S169A probably benign Het
Thnsl1 A G 2: 21,216,477 (GRCm39) D77G probably benign Het
Tsr1 T A 11: 74,798,767 (GRCm39) V712E probably damaging Het
Wdr12 C T 1: 60,128,525 (GRCm39) probably benign Het
Xdh T A 17: 74,250,886 (GRCm39) N22I probably damaging Het
Zfp3 T A 11: 70,662,395 (GRCm39) L118Q probably benign Het
Zfp592 A G 7: 80,687,623 (GRCm39) N883D probably benign Het
Zfp609 T A 9: 65,638,483 (GRCm39) M250L probably benign Het
Zfp94 A T 7: 24,002,495 (GRCm39) S316T probably damaging Het
Zfp955b A G 17: 33,521,947 (GRCm39) N472S probably benign Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13,523,433 (GRCm39) missense probably damaging 1.00
IGL01783:Sema3a APN 5 13,611,767 (GRCm39) missense probably damaging 1.00
IGL02423:Sema3a APN 5 13,615,776 (GRCm39) missense probably damaging 1.00
IGL02728:Sema3a APN 5 13,615,881 (GRCm39) missense probably damaging 1.00
IGL02739:Sema3a APN 5 13,501,128 (GRCm39) missense probably damaging 1.00
IGL02987:Sema3a APN 5 13,615,863 (GRCm39) missense probably damaging 1.00
IGL03106:Sema3a APN 5 13,649,456 (GRCm39) missense probably damaging 1.00
R0055:Sema3a UTSW 5 13,450,004 (GRCm39) missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13,607,268 (GRCm39) missense probably damaging 0.99
R0750:Sema3a UTSW 5 13,607,092 (GRCm39) critical splice donor site probably null
R1204:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably benign
R1221:Sema3a UTSW 5 13,566,190 (GRCm39) missense probably benign
R1484:Sema3a UTSW 5 13,523,407 (GRCm39) missense probably damaging 1.00
R1663:Sema3a UTSW 5 13,607,092 (GRCm39) critical splice donor site probably null
R2079:Sema3a UTSW 5 13,501,098 (GRCm39) missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13,523,364 (GRCm39) critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13,620,125 (GRCm39) missense probably damaging 1.00
R4867:Sema3a UTSW 5 13,501,208 (GRCm39) missense probably benign 0.05
R4904:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
R5107:Sema3a UTSW 5 13,627,572 (GRCm39) nonsense probably null
R5327:Sema3a UTSW 5 13,649,357 (GRCm39) missense probably benign 0.25
R5343:Sema3a UTSW 5 13,523,373 (GRCm39) missense probably damaging 1.00
R5430:Sema3a UTSW 5 13,615,730 (GRCm39) missense probably damaging 0.97
R5604:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R5774:Sema3a UTSW 5 13,573,131 (GRCm39) missense probably damaging 1.00
R6057:Sema3a UTSW 5 13,615,832 (GRCm39) missense probably damaging 1.00
R6110:Sema3a UTSW 5 13,630,969 (GRCm39) missense probably damaging 1.00
R6132:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably null
R6310:Sema3a UTSW 5 13,606,986 (GRCm39) missense probably damaging 1.00
R6754:Sema3a UTSW 5 13,649,243 (GRCm39) missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13,647,584 (GRCm39) missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13,505,511 (GRCm39) missense possibly damaging 0.88
R7411:Sema3a UTSW 5 13,566,230 (GRCm39) nonsense probably null
R7501:Sema3a UTSW 5 13,607,008 (GRCm39) missense probably damaging 1.00
R7514:Sema3a UTSW 5 13,573,093 (GRCm39) missense probably benign 0.03
R7531:Sema3a UTSW 5 13,615,805 (GRCm39) missense probably damaging 1.00
R7538:Sema3a UTSW 5 13,611,787 (GRCm39) missense probably benign 0.42
R7970:Sema3a UTSW 5 13,649,375 (GRCm39) missense possibly damaging 0.93
R8121:Sema3a UTSW 5 13,649,215 (GRCm39) missense probably damaging 1.00
R8283:Sema3a UTSW 5 13,450,030 (GRCm39) missense probably damaging 0.98
R8434:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R8918:Sema3a UTSW 5 13,573,099 (GRCm39) missense probably damaging 1.00
R9500:Sema3a UTSW 5 13,615,854 (GRCm39) missense possibly damaging 0.88
X0064:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTAGCATCAGGTCAAATGAGCC -3'
(R):5'- GAAAAGCCGTTCCATAAGCAAGTGTG -3'

Sequencing Primer
(F):5'- GCCTGAAAAAGTGAGCTAAGC -3'
(R):5'- ACTTCACACACATAAGTTCAATCTTC -3'
Posted On 2014-08-18