Incidental Mutation 'R0684:Dhrs13'
ID218633
Institutional Source Beutler Lab
Gene Symbol Dhrs13
Ensembl Gene ENSMUSG00000020834
Gene Namedehydrogenase/reductase (SDR family) member 13
Synonyms
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0684 (G1)
Quality Score57
Status Validated
Chromosome11
Chromosomal Location78032280-78037866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78036963 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 212 (A212S)
Ref Sequence ENSEMBL: ENSMUSP00000112553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021187] [ENSMUST00000072289] [ENSMUST00000073660] [ENSMUST00000092881] [ENSMUST00000100784] [ENSMUST00000122342] [ENSMUST00000144028] [ENSMUST00000148162]
Predicted Effect probably damaging
Transcript: ENSMUST00000021187
AA Change: A262S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021187
Gene: ENSMUSG00000020834
AA Change: A262S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:KR 37 176 1.6e-10 PFAM
Pfam:adh_short 37 238 6e-32 PFAM
Pfam:Epimerase 39 256 3.4e-7 PFAM
low complexity region 317 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072289
SMART Domains Protein: ENSMUSP00000072136
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073660
SMART Domains Protein: ENSMUSP00000073342
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 87 269 1.34e-10 SMART
Pfam:Flot 311 422 5.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092881
SMART Domains Protein: ENSMUSP00000090557
Gene: ENSMUSG00000020834

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:adh_short 37 111 3.2e-9 PFAM
Pfam:NAD_binding_10 39 116 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100784
SMART Domains Protein: ENSMUSP00000098347
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
PHB 38 220 1.34e-10 SMART
Blast:PHB 277 347 2e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000122342
AA Change: A212S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112553
Gene: ENSMUSG00000020834
AA Change: A212S

DomainStartEndE-ValueType
Pfam:adh_short 1 131 9.1e-17 PFAM
low complexity region 267 292 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136353
Predicted Effect probably benign
Transcript: ENSMUST00000144028
Predicted Effect probably benign
Transcript: ENSMUST00000148162
SMART Domains Protein: ENSMUSP00000133147
Gene: ENSMUSG00000061981

DomainStartEndE-ValueType
Blast:PHB 2 74 2e-34 BLAST
PDB:1WIN|A 40 74 2e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150471
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Dhrs13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0594:Dhrs13 UTSW 11 78034525 missense probably damaging 0.98
R0890:Dhrs13 UTSW 11 78034350 missense probably null 1.00
R4424:Dhrs13 UTSW 11 78037125 nonsense probably null
R5038:Dhrs13 UTSW 11 78032430 unclassified probably benign
R6151:Dhrs13 UTSW 11 78036982 missense probably damaging 1.00
R6306:Dhrs13 UTSW 11 78032693 missense probably damaging 0.97
R6765:Dhrs13 UTSW 11 78037139 missense probably benign
R7177:Dhrs13 UTSW 11 78034382 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TATACAGGCCGTTAGGCTGGTAGG -3'
(R):5'- CATCATCATCGTCTCCAGGTGCAAG -3'

Sequencing Primer
(F):5'- TGGAAGCAGATTCTACCGTC -3'
(R):5'- AAGCCCTGCCAACTTCTTG -3'
Posted On2014-08-18