Incidental Mutation 'R0841:Ugt3a1'
ID218656
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene NameUDP glycosyltransferases 3 family, polypeptide A1
Synonyms
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0841 (G1)
Quality Score27
Status Validated
Chromosome15
Chromosomal Location9276888-9315032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9306128 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 121 (S121N)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861]
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: S121N

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: S121N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176173
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTCAGGCTACAGAGCCTCTTTCCT -3'
(R):5'- GGCGTTTGGTAACCCAAAGTCCATA -3'

Sequencing Primer
(F):5'- tcctcctgtctccattccc -3'
(R):5'- ACCCAAAGTCCATATAGCTAAATTG -3'
Posted On2014-08-18