Incidental Mutation 'R0689:Sgip1'
ID218716
Institutional Source Beutler Lab
Gene Symbol Sgip1
Ensembl Gene ENSMUSG00000028524
Gene NameSH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms3110007P09Rik
MMRRC Submission 038874-MU
Accession Numbers

Genbank: NM_144906; MGI: 1920344

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0689 (G1)
Quality Score27
Status Validated
Chromosome4
Chromosomal Location102741297-102973628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102966252 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 690 (D690V)
Ref Sequence ENSEMBL: ENSMUSP00000079553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066824] [ENSMUST00000072481] [ENSMUST00000080728] [ENSMUST00000106882]
Predicted Effect probably damaging
Transcript: ENSMUST00000066824
AA Change: D543V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063712
Gene: ENSMUSG00000028524
AA Change: D543V

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 391 658 5.9e-79 PFAM
Pfam:Adap_comp_sub 469 650 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072481
AA Change: D523V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072301
Gene: ENSMUSG00000028524
AA Change: D523V

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 371 638 5.5e-79 PFAM
Pfam:Adap_comp_sub 449 630 1.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080728
AA Change: D690V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079553
Gene: ENSMUSG00000028524
AA Change: D690V

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 538 805 9e-79 PFAM
Pfam:Adap_comp_sub 617 797 2.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106882
AA Change: D710V

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102495
Gene: ENSMUSG00000028524
AA Change: D710V

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 558 825 1.7e-74 PFAM
Pfam:Adap_comp_sub 657 809 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149348
Predicted Effect unknown
Transcript: ENSMUST00000149547
AA Change: D458V
SMART Domains Protein: ENSMUSP00000122556
Gene: ENSMUSG00000028524
AA Change: D458V

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
low complexity region 207 224 N/A INTRINSIC
low complexity region 226 247 N/A INTRINSIC
Pfam:muHD 307 574 3.9e-75 PFAM
Pfam:Adap_comp_sub 404 558 3.2e-10 PFAM
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SGIP1 functions as an endocytic protein that affects signaling by receptors in neuronal systems involved in energy homeostasis via its interaction with endophilins (see SH3GL3; MIM 603362) (Trevaskis et al., 2005 [PubMed 15919751] and Uezu et al., 2007 [PubMed 17626015]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C A 7: 28,897,049 G674W probably damaging Het
Adcy9 A G 16: 4,312,804 probably benign Het
Adgrv1 C T 13: 81,475,105 V3800I possibly damaging Het
Agl A G 3: 116,793,628 Y93H probably damaging Het
Aldh1a3 T A 7: 66,402,005 D400V probably benign Het
Bpifc A G 10: 85,960,547 probably benign Het
Cachd1 G T 4: 100,974,876 R745L probably damaging Het
Cadm3 T A 1: 173,344,452 T185S possibly damaging Het
Cep85l G T 10: 53,348,847 D215E probably damaging Het
Ces1g A G 8: 93,328,407 S221P probably damaging Het
Cfap206 C T 4: 34,722,668 V138M probably benign Het
Csmd3 A T 15: 47,756,025 F1714I probably benign Het
Cyp4f18 A G 8: 71,995,968 L279P probably benign Het
Dnah7a G A 1: 53,620,681 Q723* probably null Het
Dnaja2 A G 8: 85,546,718 probably benign Het
Dnajc6 T C 4: 101,611,253 V162A possibly damaging Het
Dok4 T C 8: 94,870,919 T3A probably benign Het
Efcab7 T C 4: 99,904,784 W424R probably damaging Het
Fah A T 7: 84,593,184 probably null Het
Fam120a T C 13: 48,967,638 D64G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gas8 T G 8: 123,524,106 L106R probably damaging Het
Gykl1 T G 18: 52,694,051 N110K possibly damaging Het
Hsd3b3 G T 3: 98,741,979 L343I possibly damaging Het
Itch T A 2: 155,182,178 S234T possibly damaging Het
Itgbl1 A T 14: 123,827,847 I61F possibly damaging Het
Klf6 T A 13: 5,865,116 S185T probably damaging Het
Klk1b1 A C 7: 43,970,719 K202T probably benign Het
Liph T C 16: 21,968,068 Y268C probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myo9b G A 8: 71,330,756 D574N probably damaging Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Nipbl A G 15: 8,293,078 probably null Het
Olfm3 T A 3: 115,122,545 N355K probably benign Het
Olfr726 A T 14: 50,084,232 F150I probably benign Het
Pcdhb21 A G 18: 37,515,317 T500A probably benign Het
Pclo A G 5: 14,714,019 I4169V unknown Het
Pde4d T C 13: 109,740,544 S144P possibly damaging Het
Pgghg T C 7: 140,943,278 Y157H probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pla2g12a T C 3: 129,881,298 probably null Het
Ppp1r14d T C 2: 119,229,612 D63G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skp1a T C 11: 52,243,765 probably benign Het
Slc25a12 T C 2: 71,311,493 Y272C possibly damaging Het
Slc37a2 A G 9: 37,235,550 probably benign Het
Snx6 A T 12: 54,763,656 S112T probably benign Het
Sox6 A G 7: 115,486,551 V685A probably damaging Het
Taf2 A T 15: 55,063,065 V163E possibly damaging Het
Tg A T 15: 66,839,404 probably benign Het
Tmem30c A G 16: 57,270,173 Y224H probably damaging Het
Tmem45b T C 9: 31,428,583 N173D probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trerf1 C T 17: 47,319,374 noncoding transcript Het
Triobp A T 15: 78,959,988 K135* probably null Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Vmn1r63 T C 7: 5,803,610 I8V probably benign Het
Vmn2r77 A T 7: 86,811,664 I733F probably damaging Het
Vmn2r98 T C 17: 19,080,520 S595P possibly damaging Het
Zcchc2 C T 1: 106,030,504 Q504* probably null Het
Zfp2 T C 11: 50,900,907 D103G probably benign Het
Zfp59 A G 7: 27,853,717 K198R probably benign Het
Zfp64 C A 2: 168,935,201 probably benign Het
Other mutations in Sgip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Sgip1 APN 4 102928921 splice site probably benign
IGL01348:Sgip1 APN 4 102915156 splice site probably null
IGL01446:Sgip1 APN 4 102928913 critical splice donor site probably null
IGL01937:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL01945:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL02249:Sgip1 APN 4 102911470 missense probably benign 0.40
IGL03232:Sgip1 APN 4 102915054 splice site probably benign
3-1:Sgip1 UTSW 4 102967663 missense probably damaging 1.00
PIT4378001:Sgip1 UTSW 4 102921083 missense unknown
R0309:Sgip1 UTSW 4 102915157 splice site probably benign
R1563:Sgip1 UTSW 4 102966260 missense probably benign 0.38
R1715:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R1899:Sgip1 UTSW 4 102968337 critical splice donor site probably null
R2286:Sgip1 UTSW 4 102867647 missense possibly damaging 0.95
R2372:Sgip1 UTSW 4 102909791 critical splice donor site probably null
R3836:Sgip1 UTSW 4 102867700 splice site probably null
R4670:Sgip1 UTSW 4 102869754 missense probably damaging 1.00
R4697:Sgip1 UTSW 4 102934587 missense probably damaging 1.00
R4725:Sgip1 UTSW 4 102966222 missense probably damaging 1.00
R4892:Sgip1 UTSW 4 102966234 missense probably damaging 1.00
R5112:Sgip1 UTSW 4 102869769 missense probably damaging 1.00
R5236:Sgip1 UTSW 4 102927587 critical splice donor site probably null
R5285:Sgip1 UTSW 4 102921477 unclassified probably benign
R5323:Sgip1 UTSW 4 102966280 missense probably damaging 1.00
R5384:Sgip1 UTSW 4 102934566 missense possibly damaging 0.46
R5386:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R5682:Sgip1 UTSW 4 102967650 missense possibly damaging 0.88
R6226:Sgip1 UTSW 4 102966195 missense probably damaging 1.00
R6371:Sgip1 UTSW 4 102966285 missense probably damaging 1.00
R6594:Sgip1 UTSW 4 102962479 missense probably damaging 0.98
R6656:Sgip1 UTSW 4 102905568 intron probably benign
R6800:Sgip1 UTSW 4 102921028 unclassified probably benign
R6855:Sgip1 UTSW 4 102962376 missense probably damaging 0.99
R6917:Sgip1 UTSW 4 102968191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACCACAGCCTCTGGTTTTAG -3'
(R):5'- AGGAAAGCCTCTGCTCCATGCTTG -3'

Sequencing Primer
(F):5'- CAGCCTCTGGTTTTAGATCAACAG -3'
(R):5'- GCTTGCATGGTCAGCTAAAC -3'
Posted On2014-08-20