Incidental Mutation 'R0699:2010300C02Rik'
ID218727
Institutional Source Beutler Lab
Gene Symbol 2010300C02Rik
Ensembl Gene ENSMUSG00000026090
Gene NameRIKEN cDNA 2010300C02 gene
Synonyms
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0699 (G1)
Quality Score40
Status Validated
Chromosome1
Chromosomal Location37611677-37720085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37612330 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1152 (D1152G)
Ref Sequence ENSEMBL: ENSMUSP00000123803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162875]
Predicted Effect unknown
Transcript: ENSMUST00000160023
AA Change: D628G
SMART Domains Protein: ENSMUSP00000125015
Gene: ENSMUSG00000026090
AA Change: D628G

DomainStartEndE-ValueType
internal_repeat_1 2 65 4.52e-24 PROSPERO
internal_repeat_1 65 128 4.52e-24 PROSPERO
low complexity region 181 194 N/A INTRINSIC
low complexity region 223 237 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
low complexity region 441 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160659
Predicted Effect possibly damaging
Transcript: ENSMUST00000162875
AA Change: D1152G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123803
Gene: ENSMUSG00000026090
AA Change: D1152G

DomainStartEndE-ValueType
low complexity region 13 43 N/A INTRINSIC
Pfam:DUF4592 130 243 1.8e-33 PFAM
low complexity region 347 366 N/A INTRINSIC
internal_repeat_2 387 461 2.31e-5 PROSPERO
internal_repeat_3 404 474 3.67e-5 PROSPERO
internal_repeat_1 411 526 3.02e-34 PROSPERO
internal_repeat_2 485 559 2.31e-5 PROSPERO
internal_repeat_1 537 652 3.02e-34 PROSPERO
internal_repeat_3 570 698 3.67e-5 PROSPERO
low complexity region 705 718 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 965 989 N/A INTRINSIC
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aimp1 A T 3: 132,674,865 probably benign Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in 2010300C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:2010300C02Rik APN 1 37628344 missense probably damaging 0.99
IGL01413:2010300C02Rik APN 1 37612306 missense possibly damaging 0.85
IGL01812:2010300C02Rik APN 1 37625365 missense probably benign 0.06
IGL02183:2010300C02Rik APN 1 37625378 missense possibly damaging 0.93
IGL02498:2010300C02Rik APN 1 37623845 missense probably benign
IGL02713:2010300C02Rik APN 1 37624137 missense possibly damaging 0.72
IGL02736:2010300C02Rik APN 1 37637873 missense probably damaging 1.00
FR4449:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4449:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4548:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
FR4737:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4737:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4976:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0055:2010300C02Rik UTSW 1 37624256 missense probably benign 0.18
R0153:2010300C02Rik UTSW 1 37624639 missense probably benign
R0523:2010300C02Rik UTSW 1 37644629 start codon destroyed probably null 0.94
R0928:2010300C02Rik UTSW 1 37624582 missense possibly damaging 0.85
R1457:2010300C02Rik UTSW 1 37626012 nonsense probably null
R1759:2010300C02Rik UTSW 1 37625710 missense probably benign 0.00
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R2289:2010300C02Rik UTSW 1 37612261 missense possibly damaging 0.53
R2421:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2422:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2509:2010300C02Rik UTSW 1 37625300 missense probably benign
R2510:2010300C02Rik UTSW 1 37625300 missense probably benign
R2511:2010300C02Rik UTSW 1 37625300 missense probably benign
R3893:2010300C02Rik UTSW 1 37631458 missense probably benign 0.00
R4351:2010300C02Rik UTSW 1 37624912 missense probably benign
R4454:2010300C02Rik UTSW 1 37624753 missense probably damaging 1.00
R4788:2010300C02Rik UTSW 1 37631475 missense probably damaging 1.00
R4798:2010300C02Rik UTSW 1 37624965 missense probably benign 0.12
R5599:2010300C02Rik UTSW 1 37613343 missense possibly damaging 0.53
R5920:2010300C02Rik UTSW 1 37637981 missense probably damaging 1.00
R6051:2010300C02Rik UTSW 1 37624225 missense probably damaging 0.98
R6106:2010300C02Rik UTSW 1 37613412 missense possibly damaging 0.53
R6794:2010300C02Rik UTSW 1 37637855 splice site probably null
R6828:2010300C02Rik UTSW 1 37624817 missense possibly damaging 0.53
R6930:2010300C02Rik UTSW 1 37624945 missense possibly damaging 0.73
X0025:2010300C02Rik UTSW 1 37624945 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCGCAACATTCTTGCCACAGCC -3'
(R):5'- TGCTCCACACTCGATGCTTCAG -3'

Sequencing Primer
(F):5'- TTCTCGGAGCACATCAGAAG -3'
(R):5'- ACTCCTTTATGCACTGAGGGATTG -3'
Posted On2014-08-20